Incidental Mutation 'R2091:Sacs'
ID323571
Institutional Source Beutler Lab
Gene Symbol Sacs
Ensembl Gene ENSMUSG00000048279
Gene Namesacsin
SynonymsE130115J16Rik
MMRRC Submission 040096-MU
Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R2091 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location61138457-61240695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61191919 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 476 (I476L)
Ref Sequence ENSEMBL: ENSMUSP00000113377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119509] [ENSMUST00000119943] [ENSMUST00000121091] [ENSMUST00000227570] [ENSMUST00000229692]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089394
AA Change: I476L

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279
AA Change: I476L

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119509
AA Change: I476L

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113007
Gene: ENSMUSG00000048279
AA Change: I476L

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
SCOP:d1byqa_ 87 202 5e-3 SMART
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119943
AA Change: I476L

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: I476L

DomainStartEndE-ValueType
internal_repeat_1 61 514 1.35e-52 PROSPERO
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1526 1537 N/A INTRINSIC
low complexity region 2454 2463 N/A INTRINSIC
internal_repeat_1 2475 2934 1.35e-52 PROSPERO
low complexity region 3751 3760 N/A INTRINSIC
low complexity region 3997 4012 N/A INTRINSIC
low complexity region 4285 4300 N/A INTRINSIC
Blast:DnaJ 4304 4363 1e-31 BLAST
PDB:1IUR|A 4309 4376 5e-39 PDB
SCOP:d1gh6a_ 4317 4407 2e-3 SMART
HEPN 4454 4570 9.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121091
AA Change: I473L

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113925
Gene: ENSMUSG00000048279
AA Change: I473L

DomainStartEndE-ValueType
SCOP:d1lm8b_ 5 63 3e-3 SMART
Blast:UBQ 6 78 4e-31 BLAST
SCOP:d1byqa_ 84 199 4e-3 SMART
Blast:HATPase_c 113 208 2e-10 BLAST
low complexity region 605 620 N/A INTRINSIC
low complexity region 661 670 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150222
Predicted Effect probably benign
Transcript: ENSMUST00000227570
Predicted Effect probably benign
Transcript: ENSMUST00000229692
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (55/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G C 2: 19,517,546 N247K probably damaging Het
4930402F06Rik T C 2: 35,376,067 K197R probably benign Het
4932438A13Rik C T 3: 36,988,256 T2797I probably damaging Het
4932438A13Rik T C 3: 36,953,970 V1725A probably damaging Het
9130011E15Rik A T 19: 45,952,680 L300Q probably damaging Het
AA986860 T C 1: 130,743,169 L376P probably benign Het
Adamts10 T C 17: 33,551,192 probably null Het
Adamts7 T C 9: 90,188,440 probably null Het
Adgrl1 T C 8: 83,934,464 I862T probably damaging Het
Agbl1 G A 7: 76,589,500 V583M probably damaging Het
Apba2 T A 7: 64,695,593 V177D probably benign Het
Arfgap2 A G 2: 91,270,241 K297R probably benign Het
Atg14 A T 14: 47,542,895 I474N probably damaging Het
Atp2b4 C A 1: 133,715,230 V1046F probably benign Het
Best1 A G 19: 9,992,079 V205A probably benign Het
Bicdl1 A G 5: 115,724,579 S206P probably damaging Het
Cacna1h C T 17: 25,432,876 C98Y possibly damaging Het
Calhm3 T A 19: 47,151,991 D221V probably damaging Het
Ccdc93 T A 1: 121,483,342 probably null Het
Cd248 A T 19: 5,070,046 I641F possibly damaging Het
Chrnb3 C T 8: 27,394,234 T333M probably damaging Het
Cyb5rl A G 4: 107,071,006 H113R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddx59 T A 1: 136,416,709 D39E probably benign Het
Defa5 A G 8: 21,297,497 D20G probably damaging Het
Dido1 A T 2: 180,661,884 V1409E probably benign Het
Dlc1 A T 8: 36,937,609 V342E probably benign Het
Dsc2 G A 18: 20,033,294 T760I possibly damaging Het
Dync1h1 A G 12: 110,649,588 I3057V probably benign Het
Etnk2 T G 1: 133,377,053 probably null Het
Fbp2 G T 13: 62,858,207 L31I probably damaging Het
Gbp7 A T 3: 142,534,622 I34F probably damaging Het
Gcfc2 A G 6: 81,943,479 E415G probably damaging Het
Glp1r T C 17: 30,925,549 L232P probably damaging Het
Gm10822 A G 2: 73,899,275 noncoding transcript Het
Gm42669 G A 5: 107,507,910 V1192M probably benign Het
Gpr37 A G 6: 25,689,063 S12P possibly damaging Het
Gpt A G 15: 76,697,976 E211G possibly damaging Het
Grxcr1 T C 5: 68,110,412 I168T probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Igkv8-30 A C 6: 70,117,086 C114G probably damaging Het
Kcne4 T C 1: 78,817,907 S91P probably benign Het
Kif5b G A 18: 6,213,248 Q715* probably null Het
Lamb1 T A 12: 31,287,429 N386K probably damaging Het
Lcmt2 T C 2: 121,138,616 N662S probably damaging Het
Lnx1 G T 5: 74,620,066 H324N probably benign Het
Lrrc4 T G 6: 28,830,587 D343A probably benign Het
Mars A G 10: 127,299,285 S646P probably damaging Het
Mboat7 T C 7: 3,684,011 probably benign Het
Mlip C T 9: 77,164,863 V341I possibly damaging Het
Mterf1b A T 5: 4,197,057 T233S possibly damaging Het
Myo3a A T 2: 22,333,677 H442L probably damaging Het
Myrf A T 19: 10,224,600 V171D possibly damaging Het
Nbas G A 12: 13,361,045 D897N probably benign Het
Nfx1 T C 4: 40,977,004 V226A probably benign Het
Nlrp4a T C 7: 26,450,153 L395P probably damaging Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nsun6 A G 2: 15,039,731 probably null Het
Ntrk2 A G 13: 58,859,301 H239R possibly damaging Het
Olfr1301 A T 2: 111,754,386 M46L probably benign Het
Olfr259 T C 2: 87,108,262 N42D probably damaging Het
Olfr495 A G 7: 108,395,861 H247R probably damaging Het
Olfr979 T C 9: 40,001,204 T8A probably benign Het
Pate4 C A 9: 35,608,257 A46S possibly damaging Het
Pcdhb18 T C 18: 37,490,600 S328P probably damaging Het
Pdk4 A G 6: 5,494,857 probably benign Het
Pigm T C 1: 172,377,533 Y279H probably damaging Het
Pla2g16 A G 19: 7,579,109 I92V probably damaging Het
Plxdc2 A G 2: 16,713,683 I379M probably damaging Het
Ppp1r35 A G 5: 137,779,894 N217S possibly damaging Het
Prex1 G A 2: 166,569,365 T1438I possibly damaging Het
Ptger4 T A 15: 5,242,845 I98F possibly damaging Het
Rasl11a T A 5: 146,847,117 I124N probably damaging Het
Rest A G 5: 77,281,279 K515R possibly damaging Het
Ryr1 A G 7: 29,086,049 L1746P probably damaging Het
Ryr2 G T 13: 11,945,977 T25K probably benign Het
Serpina3g A T 12: 104,239,158 D52V probably damaging Het
Skint6 T C 4: 112,846,684 N998S probably benign Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc10a4 G A 5: 73,017,139 probably benign Het
Slc24a2 G T 4: 87,011,646 P538T probably damaging Het
Sntg1 T A 1: 8,595,539 T184S probably benign Het
Ssbp1 A G 6: 40,476,499 Y73C probably null Het
St18 G A 1: 6,827,971 V666M probably benign Het
Suclg1 A G 6: 73,264,276 K193R probably benign Het
Tcp11l1 T C 2: 104,684,139 I428V possibly damaging Het
Th T A 7: 142,895,543 D275V probably damaging Het
Tnrc18 A C 5: 142,773,641 S813R unknown Het
Tnrc6a T C 7: 123,172,120 probably null Het
Trap1 A C 16: 4,046,039 Y472* probably null Het
Trdv1 C A 14: 53,882,169 Q96K probably benign Het
Trpm8 T C 1: 88,343,326 I446T probably damaging Het
Tti2 T C 8: 31,154,266 L297P probably damaging Het
Ttn C T 2: 76,735,011 G26545R probably damaging Het
Ttn T C 2: 76,757,144 D13208G probably damaging Het
Tubb3 A G 8: 123,421,678 probably null Het
Umodl1 A G 17: 30,971,919 M247V probably benign Het
Wrn T A 8: 33,267,825 H812L probably benign Het
Zfp174 A G 16: 3,854,642 R352G possibly damaging Het
Zfp955a T A 17: 33,242,757 K134* probably null Het
Other mutations in Sacs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Sacs APN 14 61191635 missense possibly damaging 0.64
IGL01839:Sacs APN 14 61183945 intron probably benign
IGL02024:Sacs APN 14 61189678 missense probably damaging 0.96
IGL02247:Sacs APN 14 61192535 missense probably damaging 1.00
F6893:Sacs UTSW 14 61212976 missense probably benign
IGL03052:Sacs UTSW 14 61207858 missense probably damaging 0.99
R0090:Sacs UTSW 14 61205440 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0390:Sacs UTSW 14 61205640 missense possibly damaging 0.92
R0479:Sacs UTSW 14 61191479 missense probably damaging 0.99
R0556:Sacs UTSW 14 61183958 missense probably damaging 0.99
R0673:Sacs UTSW 14 61210215 missense possibly damaging 0.89
R0748:Sacs UTSW 14 61209265 missense probably damaging 0.99
R0931:Sacs UTSW 14 61203495 missense probably benign
R0972:Sacs UTSW 14 61211963 nonsense probably null
R1281:Sacs UTSW 14 61191801 missense probably benign 0.02
R1340:Sacs UTSW 14 61204509 missense probably damaging 0.98
R1351:Sacs UTSW 14 61202761 missense probably benign 0.00
R1499:Sacs UTSW 14 61213704 missense possibly damaging 0.70
R1538:Sacs UTSW 14 61210059 missense probably damaging 0.98
R1581:Sacs UTSW 14 61213679 missense probably damaging 0.96
R1599:Sacs UTSW 14 61203638 missense probably benign
R1631:Sacs UTSW 14 61210732 nonsense probably null
R1635:Sacs UTSW 14 61203828 missense probably damaging 0.98
R1655:Sacs UTSW 14 61191782 missense probably benign
R1660:Sacs UTSW 14 61209009 missense probably damaging 0.99
R1707:Sacs UTSW 14 61209762 missense probably benign 0.01
R1733:Sacs UTSW 14 61205454 missense probably damaging 1.00
R1772:Sacs UTSW 14 61210897 missense probably damaging 1.00
R1976:Sacs UTSW 14 61202895 missense probably benign
R2055:Sacs UTSW 14 61214049 missense probably damaging 0.97
R2083:Sacs UTSW 14 61206506 missense possibly damaging 0.69
R2105:Sacs UTSW 14 61173441 missense possibly damaging 0.90
R2109:Sacs UTSW 14 61173453 splice site probably null
R2117:Sacs UTSW 14 61213771 missense probably benign 0.01
R2122:Sacs UTSW 14 61212316 missense probably damaging 1.00
R2148:Sacs UTSW 14 61173378 missense probably damaging 0.97
R2151:Sacs UTSW 14 61209640 missense probably damaging 1.00
R2231:Sacs UTSW 14 61205929 unclassified probably null
R2248:Sacs UTSW 14 61212802 missense probably damaging 1.00
R2271:Sacs UTSW 14 61204660 missense probably benign 0.06
R2314:Sacs UTSW 14 61207759 missense probably benign 0.17
R2436:Sacs UTSW 14 61202905 missense possibly damaging 0.94
R2445:Sacs UTSW 14 61205206 missense probably damaging 1.00
R2512:Sacs UTSW 14 61203080 missense probably benign 0.00
R3434:Sacs UTSW 14 61212303 missense probably damaging 1.00
R3785:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3786:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3796:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3798:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3872:Sacs UTSW 14 61148068 missense probably benign 0.30
R3873:Sacs UTSW 14 61192286 missense possibly damaging 0.64
R3892:Sacs UTSW 14 61204387 missense probably damaging 0.98
R4184:Sacs UTSW 14 61213944 missense probably damaging 0.97
R4204:Sacs UTSW 14 61173443 missense possibly damaging 0.93
R4249:Sacs UTSW 14 61203457 missense probably benign 0.02
R4256:Sacs UTSW 14 61206337 missense probably damaging 1.00
R4370:Sacs UTSW 14 61212309 missense probably damaging 1.00
R4445:Sacs UTSW 14 61204686 missense probably benign 0.30
R4503:Sacs UTSW 14 61207603 missense probably damaging 1.00
R4548:Sacs UTSW 14 61191938 missense probably damaging 1.00
R4582:Sacs UTSW 14 61191698 missense probably damaging 1.00
R4613:Sacs UTSW 14 61211797 intron probably null
R4639:Sacs UTSW 14 61207268 missense probably benign 0.12
R4697:Sacs UTSW 14 61212747 missense probably benign 0.19
R4706:Sacs UTSW 14 61204273 missense probably damaging 1.00
R4717:Sacs UTSW 14 61212855 missense probably damaging 1.00
R4777:Sacs UTSW 14 61211809 missense probably damaging 1.00
R4888:Sacs UTSW 14 61212198 missense probably damaging 1.00
R4913:Sacs UTSW 14 61213797 missense probably benign 0.17
R4973:Sacs UTSW 14 61213122 missense probably damaging 1.00
R4986:Sacs UTSW 14 61213043 nonsense probably null
R5090:Sacs UTSW 14 61205253 missense probably damaging 1.00
R5243:Sacs UTSW 14 61205957 nonsense probably null
R5292:Sacs UTSW 14 61211983 missense probably damaging 1.00
R5308:Sacs UTSW 14 61192400 missense probably benign 0.21
R5337:Sacs UTSW 14 61193514 intron probably benign
R5502:Sacs UTSW 14 61206100 missense probably damaging 1.00
R5586:Sacs UTSW 14 61206441 nonsense probably null
R5692:Sacs UTSW 14 61207839 missense probably benign 0.00
R5725:Sacs UTSW 14 61211110 missense probably damaging 1.00
R5854:Sacs UTSW 14 61211547 missense probably damaging 1.00
R5959:Sacs UTSW 14 61212400 missense probably damaging 0.99
R5960:Sacs UTSW 14 61208695 missense probably benign 0.30
R5968:Sacs UTSW 14 61189629 missense probably damaging 0.99
R5983:Sacs UTSW 14 61205199 missense probably damaging 1.00
R5992:Sacs UTSW 14 61205543 missense probably damaging 1.00
R6076:Sacs UTSW 14 61204536 nonsense probably null
R6175:Sacs UTSW 14 61212826 missense possibly damaging 0.82
R6347:Sacs UTSW 14 61211160 missense probably damaging 1.00
R6357:Sacs UTSW 14 61208824 missense possibly damaging 0.47
R6415:Sacs UTSW 14 61205359 missense probably damaging 1.00
R6469:Sacs UTSW 14 61191248 missense probably damaging 1.00
R6503:Sacs UTSW 14 61211361 missense probably benign 0.00
R6523:Sacs UTSW 14 61202961 missense probably damaging 0.99
R6615:Sacs UTSW 14 61208934 missense probably benign 0.15
R6729:Sacs UTSW 14 61210518 missense probably damaging 1.00
R6797:Sacs UTSW 14 61213073 missense probably damaging 1.00
R6852:Sacs UTSW 14 61179288 missense possibly damaging 0.87
R6922:Sacs UTSW 14 61211425 missense probably damaging 1.00
X0067:Sacs UTSW 14 61208019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGGGGCATTAGTAGTAAACTG -3'
(R):5'- TCAGGCCAAAGTTTGTAGATGG -3'

Sequencing Primer
(F):5'- CGGGGCATTAGTAGTAAACTGGATTC -3'
(R):5'- GCCAAAGTTTGTAGATGGTGTCAAC -3'
Posted On2015-06-24