Incidental Mutation 'R2091:Kif5b'
ID323577
Institutional Source Beutler Lab
Gene Symbol Kif5b
Ensembl Gene ENSMUSG00000006740
Gene Namekinesin family member 5B
Synonymskinesin heavy chain, Khc
MMRRC Submission 040096-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2091 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location6201002-6242174 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 6213248 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 715 (Q715*)
Ref Sequence ENSEMBL: ENSMUSP00000025083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025083] [ENSMUST00000163210]
Predicted Effect probably null
Transcript: ENSMUST00000025083
AA Change: Q715*
SMART Domains Protein: ENSMUSP00000025083
Gene: ENSMUSG00000006740
AA Change: Q715*

DomainStartEndE-ValueType
KISc 6 333 4.48e-172 SMART
low complexity region 341 352 N/A INTRINSIC
coiled coil region 412 564 N/A INTRINSIC
coiled coil region 596 802 N/A INTRINSIC
coiled coil region 825 914 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163210
SMART Domains Protein: ENSMUSP00000130750
Gene: ENSMUSG00000006740

DomainStartEndE-ValueType
KISc 6 333 4.48e-172 SMART
low complexity region 341 352 N/A INTRINSIC
coiled coil region 412 564 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168187
Meta Mutation Damage Score 0.596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (55/57)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos during organogenesis, exhibit growth retardation and fail to turn during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G C 2: 19,517,546 N247K probably damaging Het
4930402F06Rik T C 2: 35,376,067 K197R probably benign Het
4932438A13Rik C T 3: 36,988,256 T2797I probably damaging Het
4932438A13Rik T C 3: 36,953,970 V1725A probably damaging Het
9130011E15Rik A T 19: 45,952,680 L300Q probably damaging Het
AA986860 T C 1: 130,743,169 L376P probably benign Het
Adamts10 T C 17: 33,551,192 probably null Het
Adamts7 T C 9: 90,188,440 probably null Het
Adgrl1 T C 8: 83,934,464 I862T probably damaging Het
Agbl1 G A 7: 76,589,500 V583M probably damaging Het
Apba2 T A 7: 64,695,593 V177D probably benign Het
Arfgap2 A G 2: 91,270,241 K297R probably benign Het
Atg14 A T 14: 47,542,895 I474N probably damaging Het
Atp2b4 C A 1: 133,715,230 V1046F probably benign Het
Best1 A G 19: 9,992,079 V205A probably benign Het
Bicdl1 A G 5: 115,724,579 S206P probably damaging Het
Cacna1h C T 17: 25,432,876 C98Y possibly damaging Het
Calhm3 T A 19: 47,151,991 D221V probably damaging Het
Ccdc93 T A 1: 121,483,342 probably null Het
Cd248 A T 19: 5,070,046 I641F possibly damaging Het
Chrnb3 C T 8: 27,394,234 T333M probably damaging Het
Cyb5rl A G 4: 107,071,006 H113R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddx59 T A 1: 136,416,709 D39E probably benign Het
Defa5 A G 8: 21,297,497 D20G probably damaging Het
Dido1 A T 2: 180,661,884 V1409E probably benign Het
Dlc1 A T 8: 36,937,609 V342E probably benign Het
Dsc2 G A 18: 20,033,294 T760I possibly damaging Het
Dync1h1 A G 12: 110,649,588 I3057V probably benign Het
Etnk2 T G 1: 133,377,053 probably null Het
Fbp2 G T 13: 62,858,207 L31I probably damaging Het
Gbp7 A T 3: 142,534,622 I34F probably damaging Het
Gcfc2 A G 6: 81,943,479 E415G probably damaging Het
Glp1r T C 17: 30,925,549 L232P probably damaging Het
Gm10822 A G 2: 73,899,275 noncoding transcript Het
Gm42669 G A 5: 107,507,910 V1192M probably benign Het
Gpr37 A G 6: 25,689,063 S12P possibly damaging Het
Gpt A G 15: 76,697,976 E211G possibly damaging Het
Grxcr1 T C 5: 68,110,412 I168T probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Igkv8-30 A C 6: 70,117,086 C114G probably damaging Het
Kcne4 T C 1: 78,817,907 S91P probably benign Het
Lamb1 T A 12: 31,287,429 N386K probably damaging Het
Lcmt2 T C 2: 121,138,616 N662S probably damaging Het
Lnx1 G T 5: 74,620,066 H324N probably benign Het
Lrrc4 T G 6: 28,830,587 D343A probably benign Het
Mars A G 10: 127,299,285 S646P probably damaging Het
Mboat7 T C 7: 3,684,011 probably benign Het
Mlip C T 9: 77,164,863 V341I possibly damaging Het
Mterf1b A T 5: 4,197,057 T233S possibly damaging Het
Myo3a A T 2: 22,333,677 H442L probably damaging Het
Myrf A T 19: 10,224,600 V171D possibly damaging Het
Nbas G A 12: 13,361,045 D897N probably benign Het
Nfx1 T C 4: 40,977,004 V226A probably benign Het
Nlrp4a T C 7: 26,450,153 L395P probably damaging Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nsun6 A G 2: 15,039,731 probably null Het
Ntrk2 A G 13: 58,859,301 H239R possibly damaging Het
Olfr1301 A T 2: 111,754,386 M46L probably benign Het
Olfr259 T C 2: 87,108,262 N42D probably damaging Het
Olfr495 A G 7: 108,395,861 H247R probably damaging Het
Olfr979 T C 9: 40,001,204 T8A probably benign Het
Pate4 C A 9: 35,608,257 A46S possibly damaging Het
Pcdhb18 T C 18: 37,490,600 S328P probably damaging Het
Pdk4 A G 6: 5,494,857 probably benign Het
Pigm T C 1: 172,377,533 Y279H probably damaging Het
Pla2g16 A G 19: 7,579,109 I92V probably damaging Het
Plxdc2 A G 2: 16,713,683 I379M probably damaging Het
Ppp1r35 A G 5: 137,779,894 N217S possibly damaging Het
Prex1 G A 2: 166,569,365 T1438I possibly damaging Het
Ptger4 T A 15: 5,242,845 I98F possibly damaging Het
Rasl11a T A 5: 146,847,117 I124N probably damaging Het
Rest A G 5: 77,281,279 K515R possibly damaging Het
Ryr1 A G 7: 29,086,049 L1746P probably damaging Het
Ryr2 G T 13: 11,945,977 T25K probably benign Het
Sacs A T 14: 61,191,919 I476L possibly damaging Het
Serpina3g A T 12: 104,239,158 D52V probably damaging Het
Skint6 T C 4: 112,846,684 N998S probably benign Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc10a4 G A 5: 73,017,139 probably benign Het
Slc24a2 G T 4: 87,011,646 P538T probably damaging Het
Sntg1 T A 1: 8,595,539 T184S probably benign Het
Ssbp1 A G 6: 40,476,499 Y73C probably null Het
St18 G A 1: 6,827,971 V666M probably benign Het
Suclg1 A G 6: 73,264,276 K193R probably benign Het
Tcp11l1 T C 2: 104,684,139 I428V possibly damaging Het
Th T A 7: 142,895,543 D275V probably damaging Het
Tnrc18 A C 5: 142,773,641 S813R unknown Het
Tnrc6a T C 7: 123,172,120 probably null Het
Trap1 A C 16: 4,046,039 Y472* probably null Het
Trdv1 C A 14: 53,882,169 Q96K probably benign Het
Trpm8 T C 1: 88,343,326 I446T probably damaging Het
Tti2 T C 8: 31,154,266 L297P probably damaging Het
Ttn C T 2: 76,735,011 G26545R probably damaging Het
Ttn T C 2: 76,757,144 D13208G probably damaging Het
Tubb3 A G 8: 123,421,678 probably null Het
Umodl1 A G 17: 30,971,919 M247V probably benign Het
Wrn T A 8: 33,267,825 H812L probably benign Het
Zfp174 A G 16: 3,854,642 R352G possibly damaging Het
Zfp955a T A 17: 33,242,757 K134* probably null Het
Other mutations in Kif5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Kif5b APN 18 6226973 splice site probably benign
IGL01697:Kif5b APN 18 6226871 missense possibly damaging 0.68
IGL01759:Kif5b APN 18 6225647 missense probably damaging 0.99
IGL01759:Kif5b APN 18 6211019 unclassified probably benign
IGL02027:Kif5b APN 18 6209089 missense possibly damaging 0.81
IGL02553:Kif5b APN 18 6220914 missense probably benign 0.00
IGL03327:Kif5b APN 18 6222767 missense probably damaging 0.96
IGL03346:Kif5b APN 18 6222767 missense probably damaging 0.96
e-enhancer UTSW 18 6213272 missense probably benign 0.00
R0440:Kif5b UTSW 18 6226980 splice site probably benign
R0743:Kif5b UTSW 18 6209192 missense probably damaging 1.00
R1241:Kif5b UTSW 18 6214044 missense probably benign 0.07
R1386:Kif5b UTSW 18 6226383 missense probably damaging 0.99
R1720:Kif5b UTSW 18 6213427 missense probably benign
R1964:Kif5b UTSW 18 6209059 missense possibly damaging 0.85
R2061:Kif5b UTSW 18 6226377 splice site probably null
R4510:Kif5b UTSW 18 6214011 missense probably benign 0.01
R4511:Kif5b UTSW 18 6214011 missense probably benign 0.01
R4515:Kif5b UTSW 18 6208257 missense probably benign
R4517:Kif5b UTSW 18 6213272 missense probably benign 0.00
R4690:Kif5b UTSW 18 6216759 missense probably benign
R4838:Kif5b UTSW 18 6216869 missense probably damaging 1.00
R4865:Kif5b UTSW 18 6222912 intron probably benign
R4906:Kif5b UTSW 18 6220930 missense probably benign 0.00
R5260:Kif5b UTSW 18 6211058 missense probably damaging 1.00
R5290:Kif5b UTSW 18 6234882 missense probably damaging 1.00
R5517:Kif5b UTSW 18 6220954 missense probably benign 0.00
R5588:Kif5b UTSW 18 6225787 missense probably benign 0.03
R5621:Kif5b UTSW 18 6226883 missense probably benign 0.41
R6269:Kif5b UTSW 18 6223558 missense possibly damaging 0.88
R6377:Kif5b UTSW 18 6212562 missense probably damaging 1.00
R6955:Kif5b UTSW 18 6211070 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AATCTCCTTTCACTGAACACAGG -3'
(R):5'- CTCAGGAATCTTAAGAGTCACTTTG -3'

Sequencing Primer
(F):5'- ACACAGGTTTCTATGAGGATGCC -3'
(R):5'- CTCTTACTCTCATGTACAAAACAGAG -3'
Posted On2015-06-24