Incidental Mutation 'R4332:Ccdc129'
ID323624
Institutional Source Beutler Lab
Gene Symbol Ccdc129
Ensembl Gene ENSMUSG00000037973
Gene Namecoiled-coil domain containing 129
SynonymsD530004J12Rik
MMRRC Submission 041099-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.025) question?
Stock #R4332 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location55836895-55978735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55968235 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 647 (G647D)
Ref Sequence ENSEMBL: ENSMUSP00000045332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044729]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044729
AA Change: G647D

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045332
Gene: ENSMUSG00000037973
AA Change: G647D

DomainStartEndE-ValueType
KRAP_IP3R_bind 112 264 2.99e-82 SMART
low complexity region 326 334 N/A INTRINSIC
low complexity region 432 442 N/A INTRINSIC
low complexity region 477 496 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
Pfam:SSFA2_C 806 916 3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169699
Meta Mutation Damage Score 0.0568 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T C 8: 105,709,724 I175T possibly damaging Het
A2m A G 6: 121,657,447 D646G probably benign Het
Acat2 T C 17: 12,962,895 probably benign Het
Armc10 T A 5: 21,661,581 V281E probably damaging Het
Best3 T A 10: 117,002,524 F162L probably benign Het
Ces1g T C 8: 93,319,818 M360V probably benign Het
Chd7 G T 4: 8,854,143 R1905L probably damaging Het
Dhx36 C T 3: 62,484,991 R538Q probably damaging Het
Efna2 G A 10: 80,188,481 R161Q probably damaging Het
Farsb T C 1: 78,469,266 T159A possibly damaging Het
Fry C T 5: 150,381,663 A611V probably damaging Het
Fsip2 A G 2: 82,977,857 T1507A probably benign Het
Gm11492 T G 11: 87,567,904 L368R possibly damaging Het
Gm5592 G T 7: 41,216,118 probably benign Het
Gm7367 T C 7: 60,155,616 noncoding transcript Het
Gm9312 A T 12: 24,252,094 noncoding transcript Het
Gmfg A T 7: 28,437,572 M1L probably benign Het
Gpr149 C A 3: 62,604,373 L68F possibly damaging Het
Hmga2 T C 10: 120,364,212 probably benign Het
Il12a C A 3: 68,695,261 probably benign Het
Itsn2 T A 12: 4,712,611 M1597K possibly damaging Het
Kyat3 A G 3: 142,725,426 I154M probably damaging Het
Npas3 A C 12: 54,062,069 I419L probably damaging Het
Ogfrl1 T A 1: 23,375,829 Y199F probably damaging Het
Olfr259 A G 2: 87,107,745 V214A possibly damaging Het
Olfr305 A C 7: 86,363,872 V155G probably benign Het
Olfr711 T C 7: 106,972,147 M66V probably benign Het
P2rx3 G A 2: 85,024,861 P84S probably benign Het
P3h3 A G 6: 124,842,136 V657A probably damaging Het
Pabpc2 A G 18: 39,775,340 M553V probably benign Het
Pcdhb1 T C 18: 37,265,530 F178S probably damaging Het
Plppr4 A T 3: 117,322,825 M403K probably benign Het
Ralgapa2 G A 2: 146,260,368 T1956M probably benign Het
Rbm12b1 G T 4: 12,145,655 K542N probably benign Het
Rdh8 C T 9: 20,822,629 A37V probably damaging Het
Rnf213 A G 11: 119,436,676 T1830A probably damaging Het
Sardh G T 2: 27,215,114 Q666K possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb11 G A 1: 107,369,564 probably null Het
Slc6a6 G A 6: 91,723,471 G60D probably damaging Het
Tfr2 A G 5: 137,571,734 D134G probably damaging Het
Tmprss15 T C 16: 79,034,334 T378A probably benign Het
Tmprss7 T G 16: 45,686,327 K124T probably benign Het
Urb1 A G 16: 90,774,537 L1128P probably damaging Het
Usp32 C T 11: 85,103,978 C36Y possibly damaging Het
Vmn2r50 T A 7: 10,052,995 T62S probably benign Het
Zfp110 T A 7: 12,844,571 Y136* probably null Het
Other mutations in Ccdc129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ccdc129 APN 6 55968037 missense possibly damaging 0.90
IGL01317:Ccdc129 APN 6 55967805 missense possibly damaging 0.77
IGL01390:Ccdc129 APN 6 55897998 missense probably benign 0.41
IGL01696:Ccdc129 APN 6 55897695 missense probably benign 0.40
IGL01941:Ccdc129 APN 6 55968045 missense probably benign
IGL01967:Ccdc129 APN 6 55897911 missense probably damaging 0.99
IGL02071:Ccdc129 APN 6 55967725 nonsense probably null
IGL02232:Ccdc129 APN 6 55967937 missense unknown
IGL02268:Ccdc129 APN 6 55884688 splice site probably benign
IGL02440:Ccdc129 APN 6 55884728 missense possibly damaging 0.95
IGL02614:Ccdc129 APN 6 55968277 missense probably damaging 0.99
IGL02626:Ccdc129 APN 6 55968646 missense probably benign 0.03
IGL02674:Ccdc129 APN 6 55897928 missense probably benign 0.04
IGL02836:Ccdc129 APN 6 55898090 missense probably damaging 1.00
IGL02884:Ccdc129 APN 6 55874354 splice site probably null
IGL02889:Ccdc129 APN 6 55901458 missense possibly damaging 0.46
IGL03103:Ccdc129 APN 6 55968159 missense possibly damaging 0.59
IGL03117:Ccdc129 APN 6 55898129 missense probably benign 0.25
IGL03343:Ccdc129 APN 6 55968584 missense probably damaging 1.00
R0054:Ccdc129 UTSW 6 55872472 utr 5 prime probably benign
R0200:Ccdc129 UTSW 6 55897956 missense probably benign 0.10
R0245:Ccdc129 UTSW 6 55898007 missense probably damaging 1.00
R0320:Ccdc129 UTSW 6 55976447 missense probably damaging 1.00
R0326:Ccdc129 UTSW 6 55898243 missense possibly damaging 0.61
R0357:Ccdc129 UTSW 6 55968034 missense probably benign 0.13
R1109:Ccdc129 UTSW 6 55968260 missense probably damaging 1.00
R1118:Ccdc129 UTSW 6 55889170 missense probably damaging 1.00
R1119:Ccdc129 UTSW 6 55889170 missense probably damaging 1.00
R1462:Ccdc129 UTSW 6 55975664 missense probably damaging 1.00
R1462:Ccdc129 UTSW 6 55975664 missense probably damaging 1.00
R1588:Ccdc129 UTSW 6 55978503 missense possibly damaging 0.72
R1678:Ccdc129 UTSW 6 55968514 missense probably benign 0.35
R1680:Ccdc129 UTSW 6 55968766 missense probably damaging 1.00
R1728:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1729:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1737:Ccdc129 UTSW 6 55968304 missense probably damaging 1.00
R1771:Ccdc129 UTSW 6 55898147 missense probably benign 0.40
R1784:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1936:Ccdc129 UTSW 6 55897681 missense probably damaging 1.00
R1995:Ccdc129 UTSW 6 55968709 missense probably benign 0.03
R2037:Ccdc129 UTSW 6 55897875 missense probably benign 0.00
R2137:Ccdc129 UTSW 6 55889189 missense probably damaging 1.00
R2190:Ccdc129 UTSW 6 55897700 missense possibly damaging 0.87
R2191:Ccdc129 UTSW 6 55967719 missense probably benign 0.06
R2234:Ccdc129 UTSW 6 55897812 missense possibly damaging 0.67
R2235:Ccdc129 UTSW 6 55897812 missense possibly damaging 0.67
R3793:Ccdc129 UTSW 6 55975603 missense possibly damaging 0.80
R3923:Ccdc129 UTSW 6 55968060 missense probably benign 0.19
R3959:Ccdc129 UTSW 6 55897740 missense probably benign
R4485:Ccdc129 UTSW 6 55887066 missense probably benign 0.00
R4688:Ccdc129 UTSW 6 55967147 splice site probably null
R4916:Ccdc129 UTSW 6 55978190 missense possibly damaging 0.77
R5201:Ccdc129 UTSW 6 55968006 missense probably benign 0.03
R5383:Ccdc129 UTSW 6 55978290 missense probably benign 0.38
R5450:Ccdc129 UTSW 6 55968811 critical splice donor site probably null
R5542:Ccdc129 UTSW 6 55978395 missense probably damaging 0.99
R5819:Ccdc129 UTSW 6 55897891 missense probably benign 0.18
R5935:Ccdc129 UTSW 6 55897769 nonsense probably null
R6034:Ccdc129 UTSW 6 55967681 missense possibly damaging 0.94
R6034:Ccdc129 UTSW 6 55967681 missense possibly damaging 0.94
R6209:Ccdc129 UTSW 6 55874321 missense probably damaging 1.00
R6246:Ccdc129 UTSW 6 55967672 missense probably damaging 1.00
R6463:Ccdc129 UTSW 6 55968678 missense probably benign 0.17
R6490:Ccdc129 UTSW 6 55976420 missense probably damaging 1.00
R6948:Ccdc129 UTSW 6 55978485 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTAGGCCACAAGGGTACTC -3'
(R):5'- TGGAGTGCATTCAAAAGCTGTTC -3'

Sequencing Primer
(F):5'- CTTTGAGTCACCAAGGTCATTCAGG -3'
(R):5'- AAAGCTGTTCCTTTATTATAGGTCCC -3'
Posted On2015-06-24