Incidental Mutation 'R4332:Pcdhb1'
ID323650
Institutional Source Beutler Lab
Gene Symbol Pcdhb1
Ensembl Gene ENSMUSG00000051663
Gene Nameprotocadherin beta 1
SynonymsPcdhbA
MMRRC Submission 041099-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R4332 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37264938-37267525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37265530 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 178 (F178S)
Ref Sequence ENSEMBL: ENSMUSP00000057519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052366] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000052366
AA Change: F178S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057519
Gene: ENSMUSG00000051663
AA Change: F178S

DomainStartEndE-ValueType
CA 45 131 1.04e-1 SMART
CA 155 240 1.23e-19 SMART
CA 264 345 8.4e-27 SMART
CA 369 450 5.31e-15 SMART
CA 474 560 6.27e-26 SMART
CA 590 671 6.05e-10 SMART
Pfam:Cadherin_C_2 687 772 4.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.424 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T C 8: 105,709,724 I175T possibly damaging Het
A2m A G 6: 121,657,447 D646G probably benign Het
Acat2 T C 17: 12,962,895 probably benign Het
Armc10 T A 5: 21,661,581 V281E probably damaging Het
Best3 T A 10: 117,002,524 F162L probably benign Het
Ccdc129 G A 6: 55,968,235 G647D possibly damaging Het
Ces1g T C 8: 93,319,818 M360V probably benign Het
Chd7 G T 4: 8,854,143 R1905L probably damaging Het
Dhx36 C T 3: 62,484,991 R538Q probably damaging Het
Efna2 G A 10: 80,188,481 R161Q probably damaging Het
Farsb T C 1: 78,469,266 T159A possibly damaging Het
Fry C T 5: 150,381,663 A611V probably damaging Het
Fsip2 A G 2: 82,977,857 T1507A probably benign Het
Gm11492 T G 11: 87,567,904 L368R possibly damaging Het
Gm5592 G T 7: 41,216,118 probably benign Het
Gm7367 T C 7: 60,155,616 noncoding transcript Het
Gm9312 A T 12: 24,252,094 noncoding transcript Het
Gmfg A T 7: 28,437,572 M1L probably benign Het
Gpr149 C A 3: 62,604,373 L68F possibly damaging Het
Hmga2 T C 10: 120,364,212 probably benign Het
Il12a C A 3: 68,695,261 probably benign Het
Itsn2 T A 12: 4,712,611 M1597K possibly damaging Het
Kyat3 A G 3: 142,725,426 I154M probably damaging Het
Npas3 A C 12: 54,062,069 I419L probably damaging Het
Ogfrl1 T A 1: 23,375,829 Y199F probably damaging Het
Olfr259 A G 2: 87,107,745 V214A possibly damaging Het
Olfr305 A C 7: 86,363,872 V155G probably benign Het
Olfr711 T C 7: 106,972,147 M66V probably benign Het
P2rx3 G A 2: 85,024,861 P84S probably benign Het
P3h3 A G 6: 124,842,136 V657A probably damaging Het
Pabpc2 A G 18: 39,775,340 M553V probably benign Het
Plppr4 A T 3: 117,322,825 M403K probably benign Het
Ralgapa2 G A 2: 146,260,368 T1956M probably benign Het
Rbm12b1 G T 4: 12,145,655 K542N probably benign Het
Rdh8 C T 9: 20,822,629 A37V probably damaging Het
Rnf213 A G 11: 119,436,676 T1830A probably damaging Het
Sardh G T 2: 27,215,114 Q666K possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb11 G A 1: 107,369,564 probably null Het
Slc6a6 G A 6: 91,723,471 G60D probably damaging Het
Tfr2 A G 5: 137,571,734 D134G probably damaging Het
Tmprss15 T C 16: 79,034,334 T378A probably benign Het
Tmprss7 T G 16: 45,686,327 K124T probably benign Het
Urb1 A G 16: 90,774,537 L1128P probably damaging Het
Usp32 C T 11: 85,103,978 C36Y possibly damaging Het
Vmn2r50 T A 7: 10,052,995 T62S probably benign Het
Zfp110 T A 7: 12,844,571 Y136* probably null Het
Other mutations in Pcdhb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Pcdhb1 APN 18 37267342 missense probably benign 0.06
IGL01622:Pcdhb1 APN 18 37266313 missense possibly damaging 0.73
IGL01623:Pcdhb1 APN 18 37266313 missense possibly damaging 0.73
IGL01663:Pcdhb1 APN 18 37267133 missense possibly damaging 0.83
IGL01665:Pcdhb1 APN 18 37267397 missense probably benign 0.01
IGL01780:Pcdhb1 APN 18 37266522 missense probably damaging 1.00
IGL02121:Pcdhb1 APN 18 37265785 missense probably benign 0.06
IGL02468:Pcdhb1 APN 18 37266178 missense probably benign 0.21
IGL02602:Pcdhb1 APN 18 37266796 missense probably damaging 1.00
K3955:Pcdhb1 UTSW 18 37265973 missense probably damaging 1.00
R0242:Pcdhb1 UTSW 18 37266735 missense probably benign 0.17
R0242:Pcdhb1 UTSW 18 37266735 missense probably benign 0.17
R0329:Pcdhb1 UTSW 18 37267024 missense possibly damaging 0.59
R0627:Pcdhb1 UTSW 18 37265721 missense probably damaging 1.00
R0848:Pcdhb1 UTSW 18 37267422 missense probably benign 0.00
R1187:Pcdhb1 UTSW 18 37265544 missense probably damaging 1.00
R1290:Pcdhb1 UTSW 18 37265230 missense possibly damaging 0.54
R1928:Pcdhb1 UTSW 18 37266180 nonsense probably null
R1957:Pcdhb1 UTSW 18 37265707 missense probably damaging 1.00
R2897:Pcdhb1 UTSW 18 37266463 missense probably damaging 1.00
R2898:Pcdhb1 UTSW 18 37266463 missense probably damaging 1.00
R3037:Pcdhb1 UTSW 18 37265113 missense probably damaging 1.00
R4193:Pcdhb1 UTSW 18 37267146 missense probably damaging 0.99
R4291:Pcdhb1 UTSW 18 37265417 missense probably damaging 1.00
R4308:Pcdhb1 UTSW 18 37266661 missense probably benign 0.00
R4606:Pcdhb1 UTSW 18 37265528 nonsense probably null
R4637:Pcdhb1 UTSW 18 37265749 missense possibly damaging 0.95
R5159:Pcdhb1 UTSW 18 37266363 missense possibly damaging 0.89
R5207:Pcdhb1 UTSW 18 37266462 missense probably damaging 1.00
R5211:Pcdhb1 UTSW 18 37266651 missense probably benign 0.06
R5273:Pcdhb1 UTSW 18 37265713 missense probably benign 0.23
R5335:Pcdhb1 UTSW 18 37267255 missense probably benign 0.00
R5398:Pcdhb1 UTSW 18 37266154 missense probably damaging 1.00
R5452:Pcdhb1 UTSW 18 37265758 missense possibly damaging 0.94
R5837:Pcdhb1 UTSW 18 37265827 missense possibly damaging 0.57
R5882:Pcdhb1 UTSW 18 37267177 missense probably benign 0.05
R5947:Pcdhb1 UTSW 18 37266673 missense possibly damaging 0.74
R6109:Pcdhb1 UTSW 18 37265253 missense possibly damaging 0.69
R7052:Pcdhb1 UTSW 18 37266529 missense probably damaging 1.00
R7082:Pcdhb1 UTSW 18 37266991 missense probably damaging 0.99
R7137:Pcdhb1 UTSW 18 37267392 missense possibly damaging 0.69
R7229:Pcdhb1 UTSW 18 37266687 missense probably damaging 1.00
T0970:Pcdhb1 UTSW 18 37265973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATCTGACCCGTGTGTGCTG -3'
(R):5'- TTGACGTCCAGGACAACCAC -3'

Sequencing Primer
(F):5'- TGAAATTATTCTGGCCGAGCC -3'
(R):5'- AACCACTCGAATGTTGGCG -3'
Posted On2015-06-24