Mutagenetix > Incidental Mutation

Incidental Mutation 'R4333:Rnf2'

323655

Institutional Source

Beutler Lab

Gene Symbol

Rnf2

Ensembl Gene

ENSMUSG00000026484

Gene Name

ring finger protein 2

Synonyms

Ring1B, dinG

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4333 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

151345149-151376747 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 151348827 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 98 (T98A)

Ref Sequence

ENSEMBL: ENSMUSP00000139676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076110] [ENSMUST00000186415] [ENSMUST00000187048] [ENSMUST00000187991] [ENSMUST00000190070]

AlphaFold

Q9CQJ4

Predicted Effect

probably benign
Transcript: ENSMUST00000076110
AA Change: T245A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000075476
Gene: ENSMUSG00000026484
AA Change: T245A

Domain	Start	End	E-Value	Type
RING	51	90	1.7e-7	SMART
Pfam:RAWUL	234	330	1.3e-31	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185945

Predicted Effect

probably benign
Transcript: ENSMUST00000186415
AA Change: T173A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000140594
Gene: ENSMUSG00000026484
AA Change: T173A

Domain	Start	End	E-Value	Type
RING	51	110	3.24e-4	SMART
PDB:3H8H\|A	148	258	4e-78	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000187048
AA Change: T245A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000140896
Gene: ENSMUSG00000026484
AA Change: T245A

Domain	Start	End	E-Value	Type
RING	51	90	1.7e-7	SMART
PDB:3H8H\|A	220	330	4e-77	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000187991

SMART Domains

Protein: ENSMUSP00000140299
Gene: ENSMUSG00000026484

Domain	Start	End	E-Value	Type
Pfam:zf-C3HC4	51	73	2.7e-5	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188871

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190070
AA Change: T98A

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000139676
Gene: ENSMUSG00000026484
AA Change: T98A

Domain	Start	End	E-Value	Type
Blast:RING	1	35	7e-16	BLAST
PDB:3H8H\|A	73	156	2e-56	PDB

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polycomb group (PcG) of proteins form the multiprotein complexes that are important for the transcription repression of various genes involved in development and cell proliferation. The protein encoded by this gene is one of the PcG proteins. It has been shown to interact with, and suppress the activity of, transcription factor CP2 (TFCP2/CP2). Studies of the mouse counterpart suggested the involvement of this gene in the specification of anterior-posterior axis, as well as in cell proliferation in early development. This protein was also found to interact with huntingtin interacting protein 2 (HIP2), an ubiquitin-conjugating enzyme, and possess ubiquitin ligase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a null allele show an early growth arrest, failure to progress through gastrulation, impaired epiblast expansion, accumulation of posterior mesoderm and die before E10.5. Mice homozygous for a hypomorphic allele show posterior homeotic transformations of the axial skeleton. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	C	T	10: 10,318,246 (GRCm39)	V193I	possibly damaging	Het
Cadps	C	T	14: 12,467,031 (GRCm38)	R967H	probably damaging	Het
Cwh43	A	G	5: 73,598,722 (GRCm39)	D647G	probably damaging	Het
Dab2ip	T	A	2: 35,551,632 (GRCm39)	*164R	probably null	Het
Ddx18	A	T	1: 121,492,331 (GRCm39)	D125E	probably benign	Het
Fbxw7	T	C	3: 84,879,802 (GRCm39)	C375R	probably damaging	Het
Iqca1l	A	G	5: 24,749,368 (GRCm39)	L710P	probably damaging	Het
Khnyn	A	G	14: 56,131,499 (GRCm39)	D536G	probably damaging	Het
Lamp3	T	C	16: 19,492,186 (GRCm39)	I353V	probably benign	Het
Med13	A	G	11: 86,179,009 (GRCm39)	F1429S	probably benign	Het
Mybl1	T	C	1: 9,742,523 (GRCm39)	K621E	probably damaging	Het
Myo19	G	A	11: 84,799,114 (GRCm39)	A816T	probably benign	Het
Or10d1c	A	G	9: 38,893,884 (GRCm39)	I152T	possibly damaging	Het
Or51h7	A	T	7: 102,591,176 (GRCm39)	L203I	possibly damaging	Het
Samm50	A	G	15: 84,087,031 (GRCm39)	K280R	probably benign	Het
Satb2	T	C	1: 56,884,745 (GRCm39)	N511S	probably damaging	Het
Tbc1d19	A	G	5: 54,029,619 (GRCm39)	T327A	possibly damaging	Het
Ttn	A	T	2: 76,641,587 (GRCm39)	L5176Q	possibly damaging	Het
Vmn2r7	T	C	3: 64,598,199 (GRCm39)	N786S	probably damaging	Het

Other mutations in Rnf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02515:Rnf2	APN	1	151,347,446 (GRCm39)	missense	probably benign	0.03
R1913:Rnf2	UTSW	1	151,351,936 (GRCm39)	missense	probably damaging	1.00
R4965:Rnf2	UTSW	1	151,348,968 (GRCm39)	nonsense	probably null
R6323:Rnf2	UTSW	1	151,348,967 (GRCm39)	missense	probably damaging	0.98
R6886:Rnf2	UTSW	1	151,349,017 (GRCm39)	missense	possibly damaging	0.85
R7386:Rnf2	UTSW	1	151,347,131 (GRCm39)	missense	probably damaging	1.00
R7474:Rnf2	UTSW	1	151,347,467 (GRCm39)	missense	probably benign
R9055:Rnf2	UTSW	1	151,352,030 (GRCm39)	missense	probably damaging	1.00
R9125:Rnf2	UTSW	1	151,347,433 (GRCm39)	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CTGTGAAGAGCAACTTTTCATGG -3'
(R):5'- CCCACTGTAGTAACGCATCC -3'

Sequencing Primer
(F):5'- TTTTCATGGAAAGAATATAAGGAGGG -3'
(R):5'- TGTAGTAACGCATCCACACACAG -3'

Posted On

2015-06-24