Incidental Mutation 'R4333:4931409K22Rik'
ID323660
Institutional Source Beutler Lab
Gene Symbol 4931409K22Rik
Ensembl Gene ENSMUSG00000038199
Gene NameRIKEN cDNA 4931409K22 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R4333 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location24543432-24556809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24544370 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 710 (L710P)
Ref Sequence ENSEMBL: ENSMUSP00000085642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048302] [ENSMUST00000088302] [ENSMUST00000117900] [ENSMUST00000119657] [ENSMUST00000200634]
Predicted Effect probably benign
Transcript: ENSMUST00000048302
SMART Domains Protein: ENSMUSP00000041539
Gene: ENSMUSG00000038204

DomainStartEndE-ValueType
ANK 115 144 2.62e-4 SMART
ANK 147 176 3.51e-5 SMART
ANK 180 209 7.99e2 SMART
ANK 214 243 1.44e-1 SMART
ANK 247 289 2.39e2 SMART
ANK 293 322 3.01e-4 SMART
ANK 326 362 1.46e2 SMART
SOCS_box 422 461 6.77e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000088302
AA Change: L710P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085642
Gene: ENSMUSG00000038199
AA Change: L710P

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
low complexity region 184 198 N/A INTRINSIC
IQ 205 227 7.58e-2 SMART
coiled coil region 335 382 N/A INTRINSIC
coiled coil region 429 450 N/A INTRINSIC
low complexity region 467 484 N/A INTRINSIC
Pfam:AAA 568 700 1.6e-14 PFAM
low complexity region 819 825 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117900
SMART Domains Protein: ENSMUSP00000112743
Gene: ENSMUSG00000038204

DomainStartEndE-ValueType
ANK 100 129 2.62e-4 SMART
ANK 132 161 3.51e-5 SMART
ANK 165 194 7.99e2 SMART
ANK 199 228 1.44e-1 SMART
ANK 232 274 2.39e2 SMART
ANK 278 307 3.01e-4 SMART
ANK 311 347 1.46e2 SMART
SOCS_box 407 446 6.77e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119657
SMART Domains Protein: ENSMUSP00000113328
Gene: ENSMUSG00000038204

DomainStartEndE-ValueType
ANK 115 144 2.62e-4 SMART
ANK 147 176 3.51e-5 SMART
ANK 180 209 7.99e2 SMART
ANK 214 243 1.44e-1 SMART
ANK 247 289 2.39e2 SMART
ANK 293 322 3.01e-4 SMART
ANK 326 362 1.46e2 SMART
SOCS_box 384 423 6.77e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199185
Predicted Effect probably benign
Transcript: ENSMUST00000200634
SMART Domains Protein: ENSMUSP00000142624
Gene: ENSMUSG00000038199

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
low complexity region 184 198 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb C T 10: 10,442,502 V193I possibly damaging Het
Cadps C T 14: 12,467,031 R967H probably damaging Het
Cwh43 A G 5: 73,441,379 D647G probably damaging Het
Dab2ip T A 2: 35,661,620 *164R probably null Het
Ddx18 A T 1: 121,564,602 D125E probably benign Het
Fbxw7 T C 3: 84,972,495 C375R probably damaging Het
Khnyn A G 14: 55,894,042 D536G probably damaging Het
Lamp3 T C 16: 19,673,436 I353V probably benign Het
Med13 A G 11: 86,288,183 F1429S probably benign Het
Mybl1 T C 1: 9,672,298 K621E probably damaging Het
Myo19 G A 11: 84,908,288 A816T probably benign Het
Olfr573-ps1 A T 7: 102,941,969 L203I possibly damaging Het
Olfr934 A G 9: 38,982,588 I152T possibly damaging Het
Rnf2 T C 1: 151,473,076 T98A possibly damaging Het
Samm50 A G 15: 84,202,830 K280R probably benign Het
Satb2 T C 1: 56,845,586 N511S probably damaging Het
Tbc1d19 A G 5: 53,872,277 T327A possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r7 T C 3: 64,690,778 N786S probably damaging Het
Other mutations in 4931409K22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:4931409K22Rik APN 5 24548294 missense probably benign 0.03
IGL02110:4931409K22Rik APN 5 24548084 splice site probably benign
R0329:4931409K22Rik UTSW 5 24545785 unclassified probably null
R0492:4931409K22Rik UTSW 5 24554628 missense probably damaging 1.00
R0585:4931409K22Rik UTSW 5 24550723 missense probably benign
R0656:4931409K22Rik UTSW 5 24549762 missense possibly damaging 0.67
R0894:4931409K22Rik UTSW 5 24550733 unclassified probably null
R1546:4931409K22Rik UTSW 5 24555428 utr 5 prime probably null
R1642:4931409K22Rik UTSW 5 24552688 missense probably damaging 1.00
R1998:4931409K22Rik UTSW 5 24545006 missense probably benign 0.01
R2090:4931409K22Rik UTSW 5 24550676 missense probably benign 0.15
R2186:4931409K22Rik UTSW 5 24554526 missense probably damaging 1.00
R2237:4931409K22Rik UTSW 5 24548294 missense probably benign 0.03
R2256:4931409K22Rik UTSW 5 24552040 utr 3 prime probably benign
R2257:4931409K22Rik UTSW 5 24552040 utr 3 prime probably benign
R3078:4931409K22Rik UTSW 5 24546666 missense probably benign
R3522:4931409K22Rik UTSW 5 24549626 critical splice donor site probably null
R3910:4931409K22Rik UTSW 5 24545442 splice site probably benign
R3911:4931409K22Rik UTSW 5 24545442 splice site probably benign
R4335:4931409K22Rik UTSW 5 24544370 missense probably damaging 1.00
R4500:4931409K22Rik UTSW 5 24548277 missense possibly damaging 0.85
R4761:4931409K22Rik UTSW 5 24551983 missense probably benign
R4773:4931409K22Rik UTSW 5 24550598 critical splice donor site probably null
R4880:4931409K22Rik UTSW 5 24549752 missense probably benign
R5614:4931409K22Rik UTSW 5 24550142 missense probably benign 0.03
R5839:4931409K22Rik UTSW 5 24552026 missense probably damaging 0.98
R5847:4931409K22Rik UTSW 5 24544166 missense probably benign 0.16
X0063:4931409K22Rik UTSW 5 24549765 splice site probably null
Predicted Primers PCR Primer
(F):5'- AACTCAGAGGCAACCAGTGG -3'
(R):5'- ACACTGAGCATGTAACTAGAAGAAC -3'

Sequencing Primer
(F):5'- GCAACCAGTGGCTTCTTGATAAG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2015-06-24