Mutagenetix > Incidental Mutation

Incidental Mutation 'R4333:Adgb'

323667

Institutional Source

Beutler Lab

Gene Symbol

Adgb

Ensembl Gene

ENSMUSG00000050994

Gene Name

androglobin

Synonyms

9130014G24Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4333 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10211447-10348070 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 10318246 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 193 (V193I)

Ref Sequence

ENSEMBL: ENSMUSP00000146658 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000132573] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]

AlphaFold

G3UZ78

Predicted Effect

possibly damaging
Transcript: ENSMUST00000132573
AA Change: V199I

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000120422
Gene: ENSMUSG00000050994
AA Change: V199I

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172530
AA Change: V199I

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: V199I

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART
IQ	904	926	6.41e0	SMART
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1318	1335	N/A	INTRINSIC
coiled coil region	1534	1559	N/A	INTRINSIC
low complexity region	1616	1633	N/A	INTRINSIC
low complexity region	1649	1657	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000179956
AA Change: V199I

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: V199I

Domain	Start	End	E-Value	Type
CysPc	56	657	5.36e-2	SMART
IQ	906	928	6.41e0	SMART
low complexity region	1181	1192	N/A	INTRINSIC
low complexity region	1321	1338	N/A	INTRINSIC
coiled coil region	1537	1562	N/A	INTRINSIC
low complexity region	1619	1636	N/A	INTRINSIC
low complexity region	1652	1660	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208717
AA Change: V193I

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cadps	C	T	14: 12,467,031 (GRCm38)	R967H	probably damaging	Het
Cwh43	A	G	5: 73,598,722 (GRCm39)	D647G	probably damaging	Het
Dab2ip	T	A	2: 35,551,632 (GRCm39)	*164R	probably null	Het
Ddx18	A	T	1: 121,492,331 (GRCm39)	D125E	probably benign	Het
Fbxw7	T	C	3: 84,879,802 (GRCm39)	C375R	probably damaging	Het
Iqca1l	A	G	5: 24,749,368 (GRCm39)	L710P	probably damaging	Het
Khnyn	A	G	14: 56,131,499 (GRCm39)	D536G	probably damaging	Het
Lamp3	T	C	16: 19,492,186 (GRCm39)	I353V	probably benign	Het
Med13	A	G	11: 86,179,009 (GRCm39)	F1429S	probably benign	Het
Mybl1	T	C	1: 9,742,523 (GRCm39)	K621E	probably damaging	Het
Myo19	G	A	11: 84,799,114 (GRCm39)	A816T	probably benign	Het
Or10d1c	A	G	9: 38,893,884 (GRCm39)	I152T	possibly damaging	Het
Or51h7	A	T	7: 102,591,176 (GRCm39)	L203I	possibly damaging	Het
Rnf2	T	C	1: 151,348,827 (GRCm39)	T98A	possibly damaging	Het
Samm50	A	G	15: 84,087,031 (GRCm39)	K280R	probably benign	Het
Satb2	T	C	1: 56,884,745 (GRCm39)	N511S	probably damaging	Het
Tbc1d19	A	G	5: 54,029,619 (GRCm39)	T327A	possibly damaging	Het
Ttn	A	T	2: 76,641,587 (GRCm39)	L5176Q	possibly damaging	Het
Vmn2r7	T	C	3: 64,598,199 (GRCm39)	N786S	probably damaging	Het

Other mutations in Adgb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Adgb	APN	10	10,281,843 (GRCm39)	missense	possibly damaging	0.87
IGL01083:Adgb	APN	10	10,283,298 (GRCm39)	missense	possibly damaging	0.50
IGL03064:Adgb	APN	10	10,276,316 (GRCm39)	missense	probably benign	0.02
R0080:Adgb	UTSW	10	10,253,583 (GRCm39)	splice site	probably benign
R0084:Adgb	UTSW	10	10,272,088 (GRCm39)	missense	possibly damaging	0.74
R0112:Adgb	UTSW	10	10,282,902 (GRCm39)	splice site	probably benign
R0348:Adgb	UTSW	10	10,233,623 (GRCm39)	missense	probably benign
R0415:Adgb	UTSW	10	10,306,811 (GRCm39)	splice site	probably null
R0633:Adgb	UTSW	10	10,267,473 (GRCm39)	missense	probably benign	0.36
R1052:Adgb	UTSW	10	10,318,357 (GRCm39)	missense	probably benign	0.29
R1248:Adgb	UTSW	10	10,271,054 (GRCm39)	missense	probably damaging	0.98
R1278:Adgb	UTSW	10	10,258,572 (GRCm39)	missense	probably damaging	1.00
R1568:Adgb	UTSW	10	10,318,409 (GRCm39)	nonsense	probably null
R1647:Adgb	UTSW	10	10,271,115 (GRCm39)	missense	probably damaging	1.00
R1648:Adgb	UTSW	10	10,271,115 (GRCm39)	missense	probably damaging	1.00
R1663:Adgb	UTSW	10	10,215,419 (GRCm39)	missense	possibly damaging	0.86
R1688:Adgb	UTSW	10	10,226,061 (GRCm39)	nonsense	probably null
R1758:Adgb	UTSW	10	10,302,349 (GRCm39)	missense	probably damaging	1.00
R1772:Adgb	UTSW	10	10,258,465 (GRCm39)	splice site	probably benign
R1850:Adgb	UTSW	10	10,318,246 (GRCm39)	missense	probably damaging	1.00
R1959:Adgb	UTSW	10	10,270,993 (GRCm39)	missense	probably benign	0.02
R1980:Adgb	UTSW	10	10,309,242 (GRCm39)	missense	probably benign
R2179:Adgb	UTSW	10	10,271,018 (GRCm39)	missense	possibly damaging	0.94
R2229:Adgb	UTSW	10	10,311,795 (GRCm39)	missense	probably damaging	1.00
R2283:Adgb	UTSW	10	10,253,635 (GRCm39)	missense	probably damaging	0.99
R2870:Adgb	UTSW	10	10,307,025 (GRCm39)	critical splice donor site	probably null
R2870:Adgb	UTSW	10	10,307,025 (GRCm39)	critical splice donor site	probably null
R2875:Adgb	UTSW	10	10,298,463 (GRCm39)	missense	probably damaging	1.00
R2876:Adgb	UTSW	10	10,298,463 (GRCm39)	missense	probably damaging	1.00
R2920:Adgb	UTSW	10	10,265,987 (GRCm39)	missense	probably damaging	1.00
R2931:Adgb	UTSW	10	10,318,246 (GRCm39)	missense	possibly damaging	0.84
R3722:Adgb	UTSW	10	10,216,254 (GRCm39)	missense	probably benign	0.32
R3846:Adgb	UTSW	10	10,258,465 (GRCm39)	splice site	probably benign
R3877:Adgb	UTSW	10	10,318,227 (GRCm39)	critical splice donor site	probably null
R4210:Adgb	UTSW	10	10,283,209 (GRCm39)	missense	probably benign	0.06
R4211:Adgb	UTSW	10	10,283,209 (GRCm39)	missense	probably benign	0.06
R4448:Adgb	UTSW	10	10,266,569 (GRCm39)	missense	probably benign	0.32
R4470:Adgb	UTSW	10	10,274,695 (GRCm39)	missense	probably benign	0.02
R4624:Adgb	UTSW	10	10,278,748 (GRCm39)	missense	probably benign	0.00
R4656:Adgb	UTSW	10	10,281,050 (GRCm39)	missense	probably damaging	0.99
R4676:Adgb	UTSW	10	10,302,454 (GRCm39)	missense	probably damaging	1.00
R4792:Adgb	UTSW	10	10,274,647 (GRCm39)	missense	probably damaging	0.96
R4795:Adgb	UTSW	10	10,233,616 (GRCm39)	missense	probably benign	0.01
R4858:Adgb	UTSW	10	10,225,321 (GRCm39)	missense	probably damaging	1.00
R4985:Adgb	UTSW	10	10,276,376 (GRCm39)	missense	possibly damaging	0.69
R5057:Adgb	UTSW	10	10,233,722 (GRCm39)	missense	probably benign	0.11
R5157:Adgb	UTSW	10	10,274,710 (GRCm39)	missense	probably damaging	1.00
R5209:Adgb	UTSW	10	10,274,681 (GRCm39)	missense	possibly damaging	0.71
R5339:Adgb	UTSW	10	10,318,350 (GRCm39)	missense	probably damaging	1.00
R5376:Adgb	UTSW	10	10,222,307 (GRCm39)	missense	probably benign	0.09
R5426:Adgb	UTSW	10	10,226,004 (GRCm39)	missense	probably benign	0.14
R5516:Adgb	UTSW	10	10,306,901 (GRCm39)	missense	probably damaging	1.00
R5554:Adgb	UTSW	10	10,216,217 (GRCm39)	missense	probably damaging	0.98
R5678:Adgb	UTSW	10	10,307,070 (GRCm39)	missense	possibly damaging	0.83
R5707:Adgb	UTSW	10	10,267,501 (GRCm39)	missense	probably damaging	1.00
R5708:Adgb	UTSW	10	10,267,501 (GRCm39)	missense	probably damaging	1.00
R5891:Adgb	UTSW	10	10,253,591 (GRCm39)	nonsense	probably null
R5928:Adgb	UTSW	10	10,254,531 (GRCm39)	missense	probably damaging	1.00
R6005:Adgb	UTSW	10	10,271,096 (GRCm39)	missense	probably damaging	1.00
R6017:Adgb	UTSW	10	10,325,780 (GRCm39)	missense	probably damaging	1.00
R6049:Adgb	UTSW	10	10,253,770 (GRCm39)	missense	probably damaging	1.00
R6118:Adgb	UTSW	10	10,307,035 (GRCm39)	missense	probably damaging	1.00
R6175:Adgb	UTSW	10	10,274,687 (GRCm39)	missense	possibly damaging	0.94
R6186:Adgb	UTSW	10	10,298,502 (GRCm39)	missense	probably damaging	1.00
R6234:Adgb	UTSW	10	10,228,824 (GRCm39)	splice site	probably null
R6383:Adgb	UTSW	10	10,325,772 (GRCm39)	missense	probably damaging	1.00
R6522:Adgb	UTSW	10	10,253,636 (GRCm39)	nonsense	probably null
R6639:Adgb	UTSW	10	10,311,700 (GRCm39)	missense	possibly damaging	0.51
R6697:Adgb	UTSW	10	10,281,870 (GRCm39)	nonsense	probably null
R6742:Adgb	UTSW	10	10,287,593 (GRCm39)	missense	probably damaging	1.00
R6745:Adgb	UTSW	10	10,265,941 (GRCm39)	missense	probably damaging	1.00
R6850:Adgb	UTSW	10	10,270,318 (GRCm39)	missense	probably benign	0.39
R7128:Adgb	UTSW	10	10,347,985 (GRCm39)	missense	probably benign	0.26
R7326:Adgb	UTSW	10	10,276,318 (GRCm39)	missense	possibly damaging	0.80
R7386:Adgb	UTSW	10	10,253,693 (GRCm39)	missense	possibly damaging	0.52
R7431:Adgb	UTSW	10	10,267,699 (GRCm39)	splice site	probably null
R7569:Adgb	UTSW	10	10,306,996 (GRCm39)	missense	probably benign
R7579:Adgb	UTSW	10	10,286,562 (GRCm39)	nonsense	probably null
R7582:Adgb	UTSW	10	10,266,565 (GRCm39)	missense	probably damaging	1.00
R7615:Adgb	UTSW	10	10,311,754 (GRCm39)	missense	probably damaging	0.96
R7692:Adgb	UTSW	10	10,287,456 (GRCm39)	critical splice donor site	probably null
R7774:Adgb	UTSW	10	10,215,404 (GRCm39)	nonsense	probably null
R7808:Adgb	UTSW	10	10,254,403 (GRCm39)	splice site	probably null
R8158:Adgb	UTSW	10	10,254,478 (GRCm39)	missense	probably benign	0.22
R8386:Adgb	UTSW	10	10,226,048 (GRCm39)	missense	probably damaging	1.00
R8746:Adgb	UTSW	10	10,281,028 (GRCm39)	critical splice donor site	probably null
R8785:Adgb	UTSW	10	10,233,710 (GRCm39)	missense	probably damaging	1.00
R9089:Adgb	UTSW	10	10,318,432 (GRCm39)	missense	probably benign	0.26
R9140:Adgb	UTSW	10	10,216,263 (GRCm39)	nonsense	probably null
R9386:Adgb	UTSW	10	10,274,708 (GRCm39)	missense	probably benign	0.00
R9777:Adgb	UTSW	10	10,283,214 (GRCm39)	missense	possibly damaging	0.74
X0003:Adgb	UTSW	10	10,270,374 (GRCm39)	missense	possibly damaging	0.76
Z1176:Adgb	UTSW	10	10,254,486 (GRCm39)	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- TTGCTGGAAATCATGGAACTCC -3'
(R):5'- GAGGTGGATCATCAGCGAAATC -3'

Sequencing Primer
(F):5'- GGAACTCCACCTTTAGTCTGG -3'
(R):5'- GTGGATCATCAGCGAAATCTATGCTG -3'

Posted On

2015-06-24