Incidental Mutation 'R4333:Cadps'
ID 323670
Institutional Source Beutler Lab
Gene Symbol Cadps
Ensembl Gene ENSMUSG00000054423
Gene Name Ca2+-dependent secretion activator
Synonyms CAPS1
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4333 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 9646684-10097200 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 12467031 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 967 (R967H)
Ref Sequence ENSEMBL: ENSMUSP00000064706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067491] [ENSMUST00000112657] [ENSMUST00000112658] [ENSMUST00000177814] [ENSMUST00000224882]
AlphaFold Q80TJ1
Predicted Effect probably damaging
Transcript: ENSMUST00000067491
AA Change: R967H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064706
Gene: ENSMUSG00000054423
AA Change: R967H

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 772 783 N/A INTRINSIC
DUF1041 833 948 6.21e-54 SMART
low complexity region 1022 1045 N/A INTRINSIC
low complexity region 1354 1361 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112657
AA Change: R960H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108276
Gene: ENSMUSG00000054423
AA Change: R960H

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 775 786 N/A INTRINSIC
DUF1041 836 941 3.88e-55 SMART
low complexity region 1015 1038 N/A INTRINSIC
low complexity region 1347 1354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112658
AA Change: R961H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108277
Gene: ENSMUSG00000054423
AA Change: R961H

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 776 787 N/A INTRINSIC
DUF1041 837 942 3.88e-55 SMART
low complexity region 1016 1039 N/A INTRINSIC
low complexity region 1348 1355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177814
AA Change: R962H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136076
Gene: ENSMUSG00000054423
AA Change: R962H

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 777 788 N/A INTRINSIC
DUF1041 838 943 2.75e-55 SMART
low complexity region 1017 1040 N/A INTRINSIC
low complexity region 1349 1356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224106
Predicted Effect unknown
Transcript: ENSMUST00000224581
AA Change: R140H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224704
Predicted Effect probably benign
Transcript: ENSMUST00000224882
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel neural/endocrine-specific cytosolic and peripheral membrane protein required for the Ca2+-regulated exocytosis of secretory vesicles. The protein acts at a stage in exocytosis that follows ATP-dependent priming, which involves the essential synthesis of phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). Alternative splicing has been observed at this locus and three variants, encoding distinct isoforms, are described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, respiratory failure and abnormal adrenal gland physiology. Adult heterozygous null mice display abnormal adrenal gland physiology that is different from that seen in homozygous neonates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb C T 10: 10,318,246 (GRCm39) V193I possibly damaging Het
Cwh43 A G 5: 73,598,722 (GRCm39) D647G probably damaging Het
Dab2ip T A 2: 35,551,632 (GRCm39) *164R probably null Het
Ddx18 A T 1: 121,492,331 (GRCm39) D125E probably benign Het
Fbxw7 T C 3: 84,879,802 (GRCm39) C375R probably damaging Het
Iqca1l A G 5: 24,749,368 (GRCm39) L710P probably damaging Het
Khnyn A G 14: 56,131,499 (GRCm39) D536G probably damaging Het
Lamp3 T C 16: 19,492,186 (GRCm39) I353V probably benign Het
Med13 A G 11: 86,179,009 (GRCm39) F1429S probably benign Het
Mybl1 T C 1: 9,742,523 (GRCm39) K621E probably damaging Het
Myo19 G A 11: 84,799,114 (GRCm39) A816T probably benign Het
Or10d1c A G 9: 38,893,884 (GRCm39) I152T possibly damaging Het
Or51h7 A T 7: 102,591,176 (GRCm39) L203I possibly damaging Het
Rnf2 T C 1: 151,348,827 (GRCm39) T98A possibly damaging Het
Samm50 A G 15: 84,087,031 (GRCm39) K280R probably benign Het
Satb2 T C 1: 56,884,745 (GRCm39) N511S probably damaging Het
Tbc1d19 A G 5: 54,029,619 (GRCm39) T327A possibly damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Vmn2r7 T C 3: 64,598,199 (GRCm39) N786S probably damaging Het
Other mutations in Cadps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Cadps APN 14 12,491,795 (GRCm38) missense probably damaging 1.00
IGL00990:Cadps APN 14 12,715,374 (GRCm38) missense possibly damaging 0.56
IGL01071:Cadps APN 14 12,509,091 (GRCm38) splice site probably null
IGL01339:Cadps APN 14 12,486,543 (GRCm38) missense possibly damaging 0.58
IGL01518:Cadps APN 14 12,522,352 (GRCm38) missense probably damaging 1.00
IGL01560:Cadps APN 14 12,491,792 (GRCm38) missense probably damaging 1.00
IGL01598:Cadps APN 14 12,522,202 (GRCm38) critical splice donor site probably null
IGL01603:Cadps APN 14 12,454,154 (GRCm38) splice site probably benign
IGL01836:Cadps APN 14 12,522,311 (GRCm38) missense probably damaging 1.00
IGL01839:Cadps APN 14 12,467,184 (GRCm38) splice site probably benign
IGL01932:Cadps APN 14 12,373,609 (GRCm38) utr 3 prime probably benign
IGL02172:Cadps APN 14 12,705,681 (GRCm38) missense probably damaging 1.00
IGL02175:Cadps APN 14 12,467,092 (GRCm38) missense probably damaging 0.96
IGL02212:Cadps APN 14 12,522,345 (GRCm38) missense possibly damaging 0.94
IGL02351:Cadps APN 14 12,597,380 (GRCm38) missense probably damaging 0.99
IGL02358:Cadps APN 14 12,597,380 (GRCm38) missense probably damaging 0.99
IGL02499:Cadps APN 14 12,822,725 (GRCm38) nonsense probably null
IGL02505:Cadps APN 14 12,449,759 (GRCm38) missense probably damaging 1.00
IGL02591:Cadps APN 14 12,473,465 (GRCm38) missense probably damaging 1.00
IGL02592:Cadps APN 14 12,473,465 (GRCm38) missense probably damaging 1.00
IGL02671:Cadps APN 14 12,491,824 (GRCm38) missense probably damaging 1.00
IGL02956:Cadps APN 14 12,418,047 (GRCm38) splice site probably benign
IGL03029:Cadps APN 14 12,376,675 (GRCm38) missense probably damaging 1.00
IGL03216:Cadps APN 14 12,439,944 (GRCm38) missense probably damaging 1.00
IGL03282:Cadps APN 14 12,465,856 (GRCm38) splice site probably benign
turbo UTSW 14 12,491,800 (GRCm38) missense probably damaging 1.00
R0241:Cadps UTSW 14 12,376,675 (GRCm38) missense probably damaging 1.00
R0241:Cadps UTSW 14 12,376,675 (GRCm38) missense probably damaging 1.00
R0420:Cadps UTSW 14 12,491,800 (GRCm38) missense probably damaging 1.00
R1180:Cadps UTSW 14 12,457,836 (GRCm38) splice site probably benign
R1398:Cadps UTSW 14 12,449,822 (GRCm38) missense probably damaging 1.00
R1678:Cadps UTSW 14 12,517,802 (GRCm38) critical splice donor site probably null
R1792:Cadps UTSW 14 12,449,802 (GRCm38) missense possibly damaging 0.93
R1863:Cadps UTSW 14 12,505,796 (GRCm38) missense probably benign 0.09
R1863:Cadps UTSW 14 12,449,802 (GRCm38) missense possibly damaging 0.93
R1918:Cadps UTSW 14 12,546,372 (GRCm38) missense probably damaging 0.99
R1920:Cadps UTSW 14 12,465,859 (GRCm38) missense possibly damaging 0.64
R1921:Cadps UTSW 14 12,465,859 (GRCm38) missense possibly damaging 0.64
R1922:Cadps UTSW 14 12,465,859 (GRCm38) missense possibly damaging 0.64
R1925:Cadps UTSW 14 12,705,726 (GRCm38) missense probably damaging 1.00
R1966:Cadps UTSW 14 12,822,450 (GRCm38) nonsense probably null
R2013:Cadps UTSW 14 12,522,337 (GRCm38) missense probably damaging 1.00
R2228:Cadps UTSW 14 12,465,935 (GRCm38) missense probably benign 0.05
R2331:Cadps UTSW 14 12,603,692 (GRCm38) missense probably damaging 1.00
R3436:Cadps UTSW 14 12,616,158 (GRCm38) splice site probably null
R3853:Cadps UTSW 14 12,509,090 (GRCm38) splice site probably benign
R3893:Cadps UTSW 14 12,488,883 (GRCm38) utr 3 prime probably benign
R3916:Cadps UTSW 14 12,457,702 (GRCm38) missense probably benign 0.00
R3917:Cadps UTSW 14 12,457,702 (GRCm38) missense probably benign 0.00
R3953:Cadps UTSW 14 12,505,937 (GRCm38) missense probably damaging 1.00
R3966:Cadps UTSW 14 12,522,161 (GRCm38) splice site probably null
R4024:Cadps UTSW 14 12,705,539 (GRCm38) missense probably damaging 1.00
R4079:Cadps UTSW 14 12,457,702 (GRCm38) missense probably benign 0.00
R4230:Cadps UTSW 14 12,488,987 (GRCm38) missense probably damaging 0.98
R4410:Cadps UTSW 14 12,822,323 (GRCm38) missense probably damaging 0.98
R4586:Cadps UTSW 14 12,505,808 (GRCm38) missense probably damaging 1.00
R4685:Cadps UTSW 14 12,467,139 (GRCm38) missense possibly damaging 0.77
R4698:Cadps UTSW 14 12,705,654 (GRCm38) missense possibly damaging 0.90
R4855:Cadps UTSW 14 12,822,449 (GRCm38) missense unknown
R4898:Cadps UTSW 14 12,411,588 (GRCm38) missense possibly damaging 0.86
R4908:Cadps UTSW 14 12,536,386 (GRCm38) missense probably damaging 1.00
R5208:Cadps UTSW 14 12,457,711 (GRCm38) missense possibly damaging 0.68
R5297:Cadps UTSW 14 12,822,345 (GRCm38) missense probably damaging 1.00
R5328:Cadps UTSW 14 12,457,790 (GRCm38) missense probably benign 0.31
R5408:Cadps UTSW 14 12,705,759 (GRCm38) missense possibly damaging 0.87
R5529:Cadps UTSW 14 12,454,285 (GRCm38) missense probably damaging 1.00
R5567:Cadps UTSW 14 12,473,497 (GRCm38) missense possibly damaging 0.49
R5570:Cadps UTSW 14 12,473,497 (GRCm38) missense possibly damaging 0.49
R5727:Cadps UTSW 14 12,486,525 (GRCm38) nonsense probably null
R5812:Cadps UTSW 14 12,376,685 (GRCm38) missense probably benign
R6361:Cadps UTSW 14 12,491,778 (GRCm38) nonsense probably null
R6767:Cadps UTSW 14 12,550,888 (GRCm38) missense probably damaging 1.00
R6805:Cadps UTSW 14 12,467,103 (GRCm38) missense probably damaging 0.99
R6861:Cadps UTSW 14 12,522,401 (GRCm38) nonsense probably null
R6883:Cadps UTSW 14 12,465,883 (GRCm38) missense probably damaging 0.96
R6887:Cadps UTSW 14 12,505,811 (GRCm38) missense probably damaging 1.00
R6997:Cadps UTSW 14 12,505,793 (GRCm38) missense possibly damaging 0.88
R7102:Cadps UTSW 14 12,603,738 (GRCm38) missense probably damaging 1.00
R7120:Cadps UTSW 14 12,439,919 (GRCm38) missense probably damaging 0.98
R7143:Cadps UTSW 14 12,491,838 (GRCm38) missense probably benign 0.02
R7290:Cadps UTSW 14 12,616,099 (GRCm38) missense probably damaging 1.00
R7614:Cadps UTSW 14 12,454,260 (GRCm38) missense probably damaging 1.00
R7674:Cadps UTSW 14 12,411,581 (GRCm38) missense probably damaging 0.99
R7715:Cadps UTSW 14 12,457,762 (GRCm38) missense probably benign 0.01
R7801:Cadps UTSW 14 12,489,476 (GRCm38) critical splice donor site probably null
R7814:Cadps UTSW 14 12,376,706 (GRCm38) missense probably damaging 0.99
R7915:Cadps UTSW 14 12,705,544 (GRCm38) missense possibly damaging 0.84
R8087:Cadps UTSW 14 12,536,380 (GRCm38) missense probably damaging 1.00
R8109:Cadps UTSW 14 12,488,975 (GRCm38) missense probably benign 0.00
R8485:Cadps UTSW 14 12,439,872 (GRCm38) missense probably damaging 1.00
R9156:Cadps UTSW 14 12,705,676 (GRCm38) missense probably damaging 1.00
R9158:Cadps UTSW 14 12,546,356 (GRCm38) missense probably benign 0.10
R9312:Cadps UTSW 14 12,616,095 (GRCm38) missense probably damaging 1.00
R9465:Cadps UTSW 14 12,489,002 (GRCm38) missense possibly damaging 0.93
R9519:Cadps UTSW 14 12,546,290 (GRCm38) missense possibly damaging 0.86
R9649:Cadps UTSW 14 12,597,418 (GRCm38) missense probably damaging 0.99
R9662:Cadps UTSW 14 12,411,567 (GRCm38) missense probably benign 0.02
R9674:Cadps UTSW 14 12,454,291 (GRCm38) missense probably damaging 1.00
X0018:Cadps UTSW 14 12,373,690 (GRCm38) missense probably damaging 1.00
X0028:Cadps UTSW 14 12,467,118 (GRCm38) missense possibly damaging 0.93
Z1088:Cadps UTSW 14 12,467,113 (GRCm38) missense probably damaging 0.96
Z1177:Cadps UTSW 14 12,465,880 (GRCm38) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGAACTGCTATCCACAGTTAAG -3'
(R):5'- TTCTGCCACATTTCAAAGGC -3'

Sequencing Primer
(F):5'- AACTGCTATCCACAGTTAAGTCTCTC -3'
(R):5'- ACATTTCAAAGGCCTTTGCGTG -3'
Posted On 2015-06-24