Incidental Mutation 'R4334:Pde4c'
ID323697
Institutional Source Beutler Lab
Gene Symbol Pde4c
Ensembl Gene ENSMUSG00000031842
Gene Namephosphodiesterase 4C, cAMP specific
SynonymsE130301F19Rik, dunce, Dpde1
MMRRC Submission 041664-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4334 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70723720-70751186 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 70749826 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034301] [ENSMUST00000034307] [ENSMUST00000110090] [ENSMUST00000110093] [ENSMUST00000110095] [ENSMUST00000123739] [ENSMUST00000143118] [ENSMUST00000224874]
Predicted Effect probably benign
Transcript: ENSMUST00000034301
SMART Domains Protein: ENSMUSP00000034301
Gene: ENSMUSG00000031840

DomainStartEndE-ValueType
RAB 23 186 1.27e-98 SMART
Predicted Effect probably null
Transcript: ENSMUST00000034307
SMART Domains Protein: ENSMUSP00000034307
Gene: ENSMUSG00000031842

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
HDc 386 512 1.48e0 SMART
Pfam:PDEase_I 526 598 5.3e-21 PFAM
low complexity region 625 636 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110090
SMART Domains Protein: ENSMUSP00000105717
Gene: ENSMUSG00000031840

DomainStartEndE-ValueType
RAB 23 186 1.27e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110093
SMART Domains Protein: ENSMUSP00000105720
Gene: ENSMUSG00000031840

DomainStartEndE-ValueType
RAB 23 186 1.27e-98 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110095
SMART Domains Protein: ENSMUSP00000105722
Gene: ENSMUSG00000031842

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
HDc 386 561 5.11e-6 SMART
low complexity region 659 670 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123739
SMART Domains Protein: ENSMUSP00000119312
Gene: ENSMUSG00000031842

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134693
Predicted Effect probably benign
Transcript: ENSMUST00000143118
SMART Domains Protein: ENSMUSP00000123384
Gene: ENSMUSG00000031840

DomainStartEndE-ValueType
Pfam:Miro 1 43 2.5e-6 PFAM
Pfam:Ras 1 62 3.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149272
Predicted Effect probably null
Transcript: ENSMUST00000224874
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE4 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,318,268 V447E probably damaging Het
Adcyap1 T C 17: 93,202,268 L49P probably benign Het
B4galt4 T C 16: 38,752,259 I102T probably damaging Het
Cc2d2a A G 5: 43,683,134 D110G probably benign Het
Ccdc141 C T 2: 77,170,432 V19I probably damaging Het
Ccdc39 A G 3: 33,837,882 L147P probably damaging Het
Cdc5l A T 17: 45,410,786 D519E probably benign Het
Cdh23 G T 10: 60,385,059 T1305K probably damaging Het
Cfi T A 3: 129,850,829 V158D possibly damaging Het
Clstn2 T G 9: 97,463,528 Y589S probably damaging Het
Dsp A G 13: 38,196,664 K1863E possibly damaging Het
Enpp3 A T 10: 24,793,589 M491K probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fkbp15 G A 4: 62,303,219 A1170V possibly damaging Het
Foxa2 T C 2: 148,044,703 N64S possibly damaging Het
Foxm1 T C 6: 128,365,967 I88T probably damaging Het
Gm3173 A T 14: 4,514,779 I8L possibly damaging Het
Gpatch3 A G 4: 133,582,481 D375G probably damaging Het
Herc2 T C 7: 56,226,654 F4436L probably damaging Het
Htr3b G A 9: 48,945,509 A223V probably damaging Het
Iars2 T A 1: 185,303,394 T550S probably benign Het
Igsf9 A T 1: 172,494,212 K149* probably null Het
Khnyn A G 14: 55,894,042 D536G probably damaging Het
Kng1 T C 16: 23,079,620 V409A possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Madd C T 2: 91,140,572 V1508I probably benign Het
Micall2 T C 5: 139,713,350 E527G probably damaging Het
Myo7b A G 18: 31,976,987 S1141P probably damaging Het
Ncoa2 G A 1: 13,174,963 P504S possibly damaging Het
Notch1 G A 2: 26,460,036 T2364I probably benign Het
Pik3cb A G 9: 99,061,851 L633P probably damaging Het
Ranbp2 T A 10: 58,463,994 D483E probably damaging Het
Sh3tc2 A G 18: 61,990,321 N718D probably damaging Het
Spast G A 17: 74,352,015 A126T probably damaging Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Tmprss6 T A 15: 78,459,427 probably null Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc79 C T 12: 103,078,974 T803M probably benign Het
Vmn2r118 A T 17: 55,610,347 F388L possibly damaging Het
Vmn2r71 T C 7: 85,619,834 V415A probably benign Het
Wdr4 A T 17: 31,499,152 F316Y possibly damaging Het
Zfp810 T C 9: 22,278,784 Y276C probably benign Het
Other mutations in Pde4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01938:Pde4c APN 8 70749378 missense probably damaging 1.00
IGL02052:Pde4c APN 8 70748413 missense probably damaging 0.99
IGL02484:Pde4c APN 8 70748052 splice site probably benign
IGL02567:Pde4c APN 8 70747921 missense probably benign 0.11
IGL03355:Pde4c APN 8 70746595 missense probably damaging 1.00
R0396:Pde4c UTSW 8 70750076 missense probably benign
R1103:Pde4c UTSW 8 70748417 missense probably damaging 1.00
R1161:Pde4c UTSW 8 70749923 missense possibly damaging 0.90
R1310:Pde4c UTSW 8 70749923 missense possibly damaging 0.90
R1420:Pde4c UTSW 8 70748417 missense probably damaging 1.00
R1456:Pde4c UTSW 8 70746613 missense probably benign 0.42
R1586:Pde4c UTSW 8 70746859 missense probably damaging 1.00
R1817:Pde4c UTSW 8 70726989 missense probably benign
R1818:Pde4c UTSW 8 70726989 missense probably benign
R1843:Pde4c UTSW 8 70747950 missense probably damaging 1.00
R1984:Pde4c UTSW 8 70724542 missense probably damaging 1.00
R2001:Pde4c UTSW 8 70747358 unclassified probably null
R2088:Pde4c UTSW 8 70749356 missense possibly damaging 0.88
R5369:Pde4c UTSW 8 70750105 makesense probably null
R5521:Pde4c UTSW 8 70747382 critical splice donor site probably null
R6168:Pde4c UTSW 8 70750039 missense probably benign 0.01
R6749:Pde4c UTSW 8 70746010 missense probably damaging 1.00
R7197:Pde4c UTSW 8 70745329 missense probably damaging 0.99
R7426:Pde4c UTSW 8 70748972 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CCAGCTAGGGCAGATGTTTTG -3'
(R):5'- GTCAGCTCAAACTTGAACCTGTC -3'

Sequencing Primer
(F):5'- GCCTAGAACTCACTGGCTTGAGATC -3'
(R):5'- TTGAACCTGTCCGAGCCCATG -3'
Posted On2015-06-24