Incidental Mutation 'R4334:Gm3173'
ID323707
Institutional Source Beutler Lab
Gene Symbol Gm3173
Ensembl Gene ENSMUSG00000079386
Gene Namepredicted gene 3173
Synonyms
MMRRC Submission 041664-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R4334 (G1)
Quality Score176
Status Not validated
Chromosome14
Chromosomal Location4430992-4519452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4514779 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 8 (I8L)
Ref Sequence ENSEMBL: ENSMUSP00000108396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112776] [ENSMUST00000164603] [ENSMUST00000166848]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112776
AA Change: I8L

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108396
Gene: ENSMUSG00000079386
AA Change: I8L

DomainStartEndE-ValueType
Pfam:Takusan 1 73 3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164603
SMART Domains Protein: ENSMUSP00000125850
Gene: ENSMUSG00000079386

DomainStartEndE-ValueType
Pfam:Takusan 1 74 2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166848
SMART Domains Protein: ENSMUSP00000127993
Gene: ENSMUSG00000079386

DomainStartEndE-ValueType
Pfam:Takusan 1 74 1.4e-27 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,318,268 V447E probably damaging Het
Adcyap1 T C 17: 93,202,268 L49P probably benign Het
B4galt4 T C 16: 38,752,259 I102T probably damaging Het
Cc2d2a A G 5: 43,683,134 D110G probably benign Het
Ccdc141 C T 2: 77,170,432 V19I probably damaging Het
Ccdc39 A G 3: 33,837,882 L147P probably damaging Het
Cdc5l A T 17: 45,410,786 D519E probably benign Het
Cdh23 G T 10: 60,385,059 T1305K probably damaging Het
Cfi T A 3: 129,850,829 V158D possibly damaging Het
Clstn2 T G 9: 97,463,528 Y589S probably damaging Het
Dsp A G 13: 38,196,664 K1863E possibly damaging Het
Enpp3 A T 10: 24,793,589 M491K probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fkbp15 G A 4: 62,303,219 A1170V possibly damaging Het
Foxa2 T C 2: 148,044,703 N64S possibly damaging Het
Foxm1 T C 6: 128,365,967 I88T probably damaging Het
Gpatch3 A G 4: 133,582,481 D375G probably damaging Het
Herc2 T C 7: 56,226,654 F4436L probably damaging Het
Htr3b G A 9: 48,945,509 A223V probably damaging Het
Iars2 T A 1: 185,303,394 T550S probably benign Het
Igsf9 A T 1: 172,494,212 K149* probably null Het
Khnyn A G 14: 55,894,042 D536G probably damaging Het
Kng1 T C 16: 23,079,620 V409A possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Madd C T 2: 91,140,572 V1508I probably benign Het
Micall2 T C 5: 139,713,350 E527G probably damaging Het
Myo7b A G 18: 31,976,987 S1141P probably damaging Het
Ncoa2 G A 1: 13,174,963 P504S possibly damaging Het
Notch1 G A 2: 26,460,036 T2364I probably benign Het
Pde4c T A 8: 70,749,826 probably null Het
Pik3cb A G 9: 99,061,851 L633P probably damaging Het
Ranbp2 T A 10: 58,463,994 D483E probably damaging Het
Sh3tc2 A G 18: 61,990,321 N718D probably damaging Het
Spast G A 17: 74,352,015 A126T probably damaging Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Tmprss6 T A 15: 78,459,427 probably null Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc79 C T 12: 103,078,974 T803M probably benign Het
Vmn2r118 A T 17: 55,610,347 F388L possibly damaging Het
Vmn2r71 T C 7: 85,619,834 V415A probably benign Het
Wdr4 A T 17: 31,499,152 F316Y possibly damaging Het
Zfp810 T C 9: 22,278,784 Y276C probably benign Het
Other mutations in Gm3173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Gm3173 APN 14 4514887 critical splice donor site probably null
R6021:Gm3173 UTSW 14 4514873 missense probably damaging 1.00
R6545:Gm3173 UTSW 14 4514810 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGCTTAGCAAACCAGCTGG -3'
(R):5'- GAGATGACGCACTCCATTCATG -3'

Sequencing Primer
(F):5'- CTTAGCAAACCAGCTGGAAGATAGC -3'
(R):5'- CATTCATGGAAGGAAATTGGGTTAAC -3'
Posted On2015-06-24