Incidental Mutation 'R4334:B4galt4'
ID323713
Institutional Source Beutler Lab
Gene Symbol B4galt4
Ensembl Gene ENSMUSG00000022793
Gene NameUDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 4
Synonyms
MMRRC Submission 041664-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R4334 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location38742264-38769049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38752259 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 102 (I102T)
Ref Sequence ENSEMBL: ENSMUSP00000156271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023482] [ENSMUST00000114712] [ENSMUST00000154902] [ENSMUST00000231655]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023482
AA Change: I38T

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023482
Gene: ENSMUSG00000022793
AA Change: I38T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Glyco_transf_7N 77 209 8.4e-63 PFAM
Pfam:Glyco_transf_7C 213 290 1e-30 PFAM
Pfam:Glyco_tranf_2_2 224 289 2.8e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114712
AA Change: I38T

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110360
Gene: ENSMUSG00000022793
AA Change: I38T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Glyco_transf_7N 77 211 6.2e-58 PFAM
Pfam:Glyco_transf_7C 213 290 6.9e-31 PFAM
Pfam:Glyco_tranf_2_2 224 289 3.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119414
Predicted Effect possibly damaging
Transcript: ENSMUST00000154902
AA Change: I38T

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118593
Gene: ENSMUSG00000022793
AA Change: I38T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Glyco_transf_7N 77 211 5.9e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231655
AA Change: I102T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene appears to mainly play a role in glycolipid biosynthesis. Two alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,318,268 V447E probably damaging Het
Adcyap1 T C 17: 93,202,268 L49P probably benign Het
Cc2d2a A G 5: 43,683,134 D110G probably benign Het
Ccdc141 C T 2: 77,170,432 V19I probably damaging Het
Ccdc39 A G 3: 33,837,882 L147P probably damaging Het
Cdc5l A T 17: 45,410,786 D519E probably benign Het
Cdh23 G T 10: 60,385,059 T1305K probably damaging Het
Cfi T A 3: 129,850,829 V158D possibly damaging Het
Clstn2 T G 9: 97,463,528 Y589S probably damaging Het
Dsp A G 13: 38,196,664 K1863E possibly damaging Het
Enpp3 A T 10: 24,793,589 M491K probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fkbp15 G A 4: 62,303,219 A1170V possibly damaging Het
Foxa2 T C 2: 148,044,703 N64S possibly damaging Het
Foxm1 T C 6: 128,365,967 I88T probably damaging Het
Gm3173 A T 14: 4,514,779 I8L possibly damaging Het
Gpatch3 A G 4: 133,582,481 D375G probably damaging Het
Herc2 T C 7: 56,226,654 F4436L probably damaging Het
Htr3b G A 9: 48,945,509 A223V probably damaging Het
Iars2 T A 1: 185,303,394 T550S probably benign Het
Igsf9 A T 1: 172,494,212 K149* probably null Het
Khnyn A G 14: 55,894,042 D536G probably damaging Het
Kng1 T C 16: 23,079,620 V409A possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Madd C T 2: 91,140,572 V1508I probably benign Het
Micall2 T C 5: 139,713,350 E527G probably damaging Het
Myo7b A G 18: 31,976,987 S1141P probably damaging Het
Ncoa2 G A 1: 13,174,963 P504S possibly damaging Het
Notch1 G A 2: 26,460,036 T2364I probably benign Het
Pde4c T A 8: 70,749,826 probably null Het
Pik3cb A G 9: 99,061,851 L633P probably damaging Het
Ranbp2 T A 10: 58,463,994 D483E probably damaging Het
Sh3tc2 A G 18: 61,990,321 N718D probably damaging Het
Spast G A 17: 74,352,015 A126T probably damaging Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Tmprss6 T A 15: 78,459,427 probably null Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc79 C T 12: 103,078,974 T803M probably benign Het
Vmn2r118 A T 17: 55,610,347 F388L possibly damaging Het
Vmn2r71 T C 7: 85,619,834 V415A probably benign Het
Wdr4 A T 17: 31,499,152 F316Y possibly damaging Het
Zfp810 T C 9: 22,278,784 Y276C probably benign Het
Other mutations in B4galt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:B4galt4 APN 16 38754144 missense probably damaging 1.00
IGL01414:B4galt4 APN 16 38757791 missense probably damaging 1.00
R0831:B4galt4 UTSW 16 38767979 missense probably benign 0.01
R2125:B4galt4 UTSW 16 38765938 missense probably damaging 0.99
R3950:B4galt4 UTSW 16 38768022 missense probably benign
R4773:B4galt4 UTSW 16 38752296 missense probably benign 0.37
R6499:B4galt4 UTSW 16 38757822 missense probably benign 0.00
R6706:B4galt4 UTSW 16 38757811 missense probably benign 0.06
R7208:B4galt4 UTSW 16 38753940 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGATCCCCGGTCATACTG -3'
(R):5'- ATACTTTCCCATACACCAGTGAAG -3'

Sequencing Primer
(F):5'- GGAAAAGTACAATTTGGAACCTCCTC -3'
(R):5'- CCATACACCAGTGAAGTAACTTTTTG -3'
Posted On2015-06-24