Incidental Mutation 'R4334:Wdr4'
ID323715
Institutional Source Beutler Lab
Gene Symbol Wdr4
Ensembl Gene ENSMUSG00000024037
Gene NameWD repeat domain 4
SynonymsD530049K22Rik
MMRRC Submission 041664-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R4334 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location31494323-31519974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31499152 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 316 (F316Y)
Ref Sequence ENSEMBL: ENSMUSP00000126061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167419] [ENSMUST00000171171] [ENSMUST00000171291]
Predicted Effect probably benign
Transcript: ENSMUST00000166626
SMART Domains Protein: ENSMUSP00000125954
Gene: ENSMUSG00000024037

DomainStartEndE-ValueType
SCOP:d1kb0a2 18 93 1e-2 SMART
Blast:WD40 39 91 1e-30 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166992
Predicted Effect probably benign
Transcript: ENSMUST00000167419
SMART Domains Protein: ENSMUSP00000127617
Gene: ENSMUSG00000024037

DomainStartEndE-ValueType
SCOP:d1e1aa_ 71 143 5e-4 SMART
Blast:WD40 74 134 2e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169454
Predicted Effect probably benign
Transcript: ENSMUST00000170176
SMART Domains Protein: ENSMUSP00000127073
Gene: ENSMUSG00000024037

DomainStartEndE-ValueType
SCOP:d1e1aa_ 33 105 9e-4 SMART
Blast:WD40 36 96 8e-37 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000171171
AA Change: F316Y

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126061
Gene: ENSMUSG00000024037
AA Change: F316Y

DomainStartEndE-ValueType
WD40 74 134 1.58e2 SMART
WD40 137 175 2.37e2 SMART
WD40 178 218 4.44e0 SMART
WD40 222 262 3.5e-4 SMART
low complexity region 417 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171291
Predicted Effect probably benign
Transcript: ENSMUST00000172284
SMART Domains Protein: ENSMUSP00000129736
Gene: ENSMUSG00000024037

DomainStartEndE-ValueType
Blast:WD40 36 88 2e-30 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is excluded as a candidate for a form of nonsyndromic deafness (DFNB10), but is still a candidate for other disorders mapped to 21q22.3 as well as for the development of Down syndrome phenotypes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a null allele display lethality during organogenesis with increased apoptosis and DNA damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,318,268 V447E probably damaging Het
Adcyap1 T C 17: 93,202,268 L49P probably benign Het
B4galt4 T C 16: 38,752,259 I102T probably damaging Het
Cc2d2a A G 5: 43,683,134 D110G probably benign Het
Ccdc141 C T 2: 77,170,432 V19I probably damaging Het
Ccdc39 A G 3: 33,837,882 L147P probably damaging Het
Cdc5l A T 17: 45,410,786 D519E probably benign Het
Cdh23 G T 10: 60,385,059 T1305K probably damaging Het
Cfi T A 3: 129,850,829 V158D possibly damaging Het
Clstn2 T G 9: 97,463,528 Y589S probably damaging Het
Dsp A G 13: 38,196,664 K1863E possibly damaging Het
Enpp3 A T 10: 24,793,589 M491K probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fkbp15 G A 4: 62,303,219 A1170V possibly damaging Het
Foxa2 T C 2: 148,044,703 N64S possibly damaging Het
Foxm1 T C 6: 128,365,967 I88T probably damaging Het
Gm3173 A T 14: 4,514,779 I8L possibly damaging Het
Gpatch3 A G 4: 133,582,481 D375G probably damaging Het
Herc2 T C 7: 56,226,654 F4436L probably damaging Het
Htr3b G A 9: 48,945,509 A223V probably damaging Het
Iars2 T A 1: 185,303,394 T550S probably benign Het
Igsf9 A T 1: 172,494,212 K149* probably null Het
Khnyn A G 14: 55,894,042 D536G probably damaging Het
Kng1 T C 16: 23,079,620 V409A possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Madd C T 2: 91,140,572 V1508I probably benign Het
Micall2 T C 5: 139,713,350 E527G probably damaging Het
Myo7b A G 18: 31,976,987 S1141P probably damaging Het
Ncoa2 G A 1: 13,174,963 P504S possibly damaging Het
Notch1 G A 2: 26,460,036 T2364I probably benign Het
Pde4c T A 8: 70,749,826 probably null Het
Pik3cb A G 9: 99,061,851 L633P probably damaging Het
Ranbp2 T A 10: 58,463,994 D483E probably damaging Het
Sh3tc2 A G 18: 61,990,321 N718D probably damaging Het
Spast G A 17: 74,352,015 A126T probably damaging Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Tmprss6 T A 15: 78,459,427 probably null Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc79 C T 12: 103,078,974 T803M probably benign Het
Vmn2r118 A T 17: 55,610,347 F388L possibly damaging Het
Vmn2r71 T C 7: 85,619,834 V415A probably benign Het
Zfp810 T C 9: 22,278,784 Y276C probably benign Het
Other mutations in Wdr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Wdr4 APN 17 31501258 missense possibly damaging 0.94
IGL03158:Wdr4 APN 17 31499128 missense probably benign 0.00
R0091:Wdr4 UTSW 17 31496916 missense probably benign 0.01
R1524:Wdr4 UTSW 17 31509763 intron probably benign
R2009:Wdr4 UTSW 17 31500610 splice site probably benign
R3822:Wdr4 UTSW 17 31512221 missense probably damaging 0.99
R4786:Wdr4 UTSW 17 31509811 missense probably damaging 1.00
R4873:Wdr4 UTSW 17 31499155 missense probably benign 0.05
R4875:Wdr4 UTSW 17 31499155 missense probably benign 0.05
R5117:Wdr4 UTSW 17 31499824 missense probably benign 0.00
R5372:Wdr4 UTSW 17 31510580 missense probably damaging 1.00
R5757:Wdr4 UTSW 17 31499089 missense probably damaging 0.98
R6024:Wdr4 UTSW 17 31501298 intron probably benign
R7401:Wdr4 UTSW 17 31509832 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAGATGGATGTGAACAAGGCTG -3'
(R):5'- AGTGGCCATTTCACTCTTCG -3'

Sequencing Primer
(F):5'- TCAGACCACGGAGCTGCTG -3'
(R):5'- CATTTCACTCTTCGTCCTGTATTAG -3'
Posted On2015-06-24