Mutagenetix > Incidental Mutation

Incidental Mutation 'R4335:Rxfp1'

323726

Institutional Source

Beutler Lab

Gene Symbol

Rxfp1

Ensembl Gene

ENSMUSG00000034009

Gene Name

relaxin/insulin-like family peptide receptor 1

Synonyms

LOC381489, Lgr7

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.149) question?

Stock #

R4335 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79548918-79645187 bp(-) (GRCm39)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 79594105 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000077611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078527] [ENSMUST00000182491]

AlphaFold

Q6R6I7

Predicted Effect

probably null
Transcript: ENSMUST00000078527

SMART Domains

Protein: ENSMUSP00000077611
Gene: ENSMUSG00000034009

Domain	Start	End	E-Value	Type
LDLa	26	64	1.61e-8	SMART
LRRNT	101	130	9.51e-1	SMART
LRR	126	148	3.65e1	SMART
LRR	149	172	1.19e1	SMART
LRR_TYP	173	196	4.61e-5	SMART
LRR	197	220	1.86e0	SMART
LRR	221	244	1.86e2	SMART
LRR	246	269	2.03e1	SMART
LRR	270	293	1.76e2	SMART
LRR_TYP	294	317	4.24e-4	SMART
LRR	318	341	1.15e1	SMART
LRR	342	365	3.65e1	SMART
Pfam:7tm_1	422	681	2.8e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182491

SMART Domains

Protein: ENSMUSP00000138578
Gene: ENSMUSG00000034009

Domain	Start	End	E-Value	Type
LDLa	26	64	1.61e-8	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility, particularly at younger ages and early generations. Impaired nipple development prevents nursing by females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	G	A	11: 110,042,843 (GRCm39)	T402M	probably damaging	Het
Apbb1ip	G	A	2: 22,761,574 (GRCm39)		probably null	Het
Armh1	A	T	4: 117,071,660 (GRCm39)	I308N	probably damaging	Het
Ceacam5	G	A	7: 17,486,054 (GRCm39)	R517Q	probably benign	Het
Clic4	C	T	4: 134,945,916 (GRCm39)	S167N	probably benign	Het
Ehbp1l1	A	T	19: 5,758,797 (GRCm39)	L1644Q	probably damaging	Het
Erh	A	G	12: 80,689,615 (GRCm39)	L3P	probably benign	Het
Fbxw7	T	C	3: 84,879,802 (GRCm39)	C375R	probably damaging	Het
Fhdc1	C	A	3: 84,352,133 (GRCm39)	V1031F	probably benign	Het
Fsd2	A	T	7: 81,191,813 (GRCm39)	S521R	probably damaging	Het
Garin2	T	C	12: 78,759,006 (GRCm39)	S109P	possibly damaging	Het
Hace1	A	G	10: 45,586,057 (GRCm39)	Y865C	probably damaging	Het
Iqca1l	A	G	5: 24,749,368 (GRCm39)	L710P	probably damaging	Het
Iqcf1	G	A	9: 106,379,072 (GRCm39)	R62H	possibly damaging	Het
Kcnv1	G	A	15: 44,977,840 (GRCm39)	T66M	probably damaging	Het
Leng8	T	C	7: 4,150,037 (GRCm39)	Y781H	probably damaging	Het
Med8	G	T	4: 118,266,567 (GRCm39)		probably null	Het
Myo19	G	A	11: 84,799,114 (GRCm39)	A816T	probably benign	Het
Nat8f2	A	G	6: 85,845,233 (GRCm39)	L43P	probably damaging	Het
Omd	A	C	13: 49,743,712 (GRCm39)	D254A	probably benign	Het
Psd2	G	T	18: 36,140,583 (GRCm39)	A622S	probably damaging	Het
Rnf207	G	A	4: 152,400,062 (GRCm39)		probably benign	Het
Rsbn1l	T	C	5: 21,113,191 (GRCm39)	I444V	probably null	Het
Selenot	C	A	3: 58,492,722 (GRCm39)	R70S	possibly damaging	Het
Sox6	A	G	7: 115,111,959 (GRCm39)	S557P	probably benign	Het
Sp9	G	A	2: 73,104,633 (GRCm39)	V396M	probably damaging	Het
Ston1	T	C	17: 88,943,125 (GRCm39)	F177S	probably damaging	Het
Syne2	A	G	12: 76,074,866 (GRCm39)	E4602G	probably damaging	Het
Tbc1d19	A	G	5: 54,029,619 (GRCm39)	T327A	possibly damaging	Het
Tsga13	T	C	6: 30,876,980 (GRCm39)	D179G	probably damaging	Het
Wdr27	T	A	17: 15,141,018 (GRCm39)		probably null	Het

Other mutations in Rxfp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01758:Rxfp1	APN	3	79,559,523 (GRCm39)	missense	possibly damaging	0.81
IGL01962:Rxfp1	APN	3	79,594,175 (GRCm39)	missense	probably damaging	1.00
IGL01975:Rxfp1	APN	3	79,567,385 (GRCm39)	missense	possibly damaging	0.95
IGL01998:Rxfp1	APN	3	79,567,403 (GRCm39)	missense	probably benign	0.01
IGL02049:Rxfp1	APN	3	79,557,799 (GRCm39)	missense	probably damaging	0.99
IGL02153:Rxfp1	APN	3	79,567,427 (GRCm39)	missense	probably benign	0.00
IGL02490:Rxfp1	APN	3	79,559,474 (GRCm39)	critical splice donor site	probably null
IGL02526:Rxfp1	APN	3	79,578,153 (GRCm39)	critical splice donor site	probably null
IGL02985:Rxfp1	APN	3	79,559,533 (GRCm39)	missense	possibly damaging	0.65
IGL03252:Rxfp1	APN	3	79,574,990 (GRCm39)	missense	probably benign	0.29
juggler	UTSW	3	79,557,898 (GRCm39)	nonsense	probably null
R0123:Rxfp1	UTSW	3	79,564,783 (GRCm39)	missense	probably damaging	1.00
R0134:Rxfp1	UTSW	3	79,564,783 (GRCm39)	missense	probably damaging	1.00
R0230:Rxfp1	UTSW	3	79,552,282 (GRCm39)	missense	probably damaging	1.00
R0257:Rxfp1	UTSW	3	79,589,842 (GRCm39)	missense	possibly damaging	0.61
R0265:Rxfp1	UTSW	3	79,574,961 (GRCm39)	missense	probably benign	0.00
R0362:Rxfp1	UTSW	3	79,645,100 (GRCm39)	start codon destroyed	probably null	0.99
R0394:Rxfp1	UTSW	3	79,559,684 (GRCm39)	missense	possibly damaging	0.58
R0422:Rxfp1	UTSW	3	79,558,038 (GRCm39)	missense	probably benign	0.00
R0547:Rxfp1	UTSW	3	79,612,876 (GRCm39)	splice site	probably null
R0627:Rxfp1	UTSW	3	79,555,518 (GRCm39)	missense	probably benign	0.00
R0671:Rxfp1	UTSW	3	79,570,600 (GRCm39)	splice site	probably null
R1309:Rxfp1	UTSW	3	79,570,599 (GRCm39)	splice site	probably null
R1756:Rxfp1	UTSW	3	79,578,188 (GRCm39)	missense	probably benign	0.11
R1803:Rxfp1	UTSW	3	79,645,076 (GRCm39)	missense	probably benign
R2415:Rxfp1	UTSW	3	79,570,626 (GRCm39)	missense	probably benign	0.14
R2862:Rxfp1	UTSW	3	79,589,778 (GRCm39)	missense	possibly damaging	0.80
R4087:Rxfp1	UTSW	3	79,552,256 (GRCm39)	missense	probably damaging	0.99
R4091:Rxfp1	UTSW	3	79,552,068 (GRCm39)	missense	probably benign
R4250:Rxfp1	UTSW	3	79,559,579 (GRCm39)	missense	probably benign	0.41
R4447:Rxfp1	UTSW	3	79,559,434 (GRCm39)	intron	probably benign
R4607:Rxfp1	UTSW	3	79,594,196 (GRCm39)	missense	probably damaging	1.00
R4608:Rxfp1	UTSW	3	79,594,196 (GRCm39)	missense	probably damaging	1.00
R4676:Rxfp1	UTSW	3	79,612,975 (GRCm39)	missense	probably damaging	1.00
R4768:Rxfp1	UTSW	3	79,594,175 (GRCm39)	missense	probably damaging	1.00
R4812:Rxfp1	UTSW	3	79,557,889 (GRCm39)	missense	probably benign	0.00
R4909:Rxfp1	UTSW	3	79,552,109 (GRCm39)	missense	probably benign
R5059:Rxfp1	UTSW	3	79,570,619 (GRCm39)	missense	probably benign
R5131:Rxfp1	UTSW	3	79,559,471 (GRCm39)	splice site	probably null
R5641:Rxfp1	UTSW	3	79,594,199 (GRCm39)	missense	probably damaging	0.98
R5711:Rxfp1	UTSW	3	79,586,054 (GRCm39)	missense	probably damaging	1.00
R5757:Rxfp1	UTSW	3	79,568,627 (GRCm39)	missense	possibly damaging	0.89
R5856:Rxfp1	UTSW	3	79,570,620 (GRCm39)	missense	possibly damaging	0.76
R6296:Rxfp1	UTSW	3	79,575,155 (GRCm39)	missense	probably damaging	1.00
R6462:Rxfp1	UTSW	3	79,555,596 (GRCm39)	missense	probably benign	0.07
R6730:Rxfp1	UTSW	3	79,557,898 (GRCm39)	nonsense	probably null
R7059:Rxfp1	UTSW	3	79,559,576 (GRCm39)	missense	probably damaging	1.00
R7530:Rxfp1	UTSW	3	79,557,768 (GRCm39)	missense	probably benign	0.18
R7626:Rxfp1	UTSW	3	79,555,397 (GRCm39)	missense	probably damaging	0.99
R7684:Rxfp1	UTSW	3	79,578,214 (GRCm39)	missense	possibly damaging	0.66
R7951:Rxfp1	UTSW	3	79,559,682 (GRCm39)	missense	probably damaging	1.00
R8723:Rxfp1	UTSW	3	79,557,802 (GRCm39)	missense	probably benign
R8786:Rxfp1	UTSW	3	79,570,677 (GRCm39)	critical splice acceptor site	probably null
R8887:Rxfp1	UTSW	3	79,559,289 (GRCm39)	intron	probably benign
R8939:Rxfp1	UTSW	3	79,552,231 (GRCm39)	missense	probably damaging	0.99
R9245:Rxfp1	UTSW	3	79,552,261 (GRCm39)	missense	probably benign	0.12
R9574:Rxfp1	UTSW	3	79,563,581 (GRCm39)	missense	probably benign	0.01
R9579:Rxfp1	UTSW	3	79,557,946 (GRCm39)	missense	probably damaging	1.00
R9799:Rxfp1	UTSW	3	79,578,182 (GRCm39)	missense	probably damaging	1.00
Z1088:Rxfp1	UTSW	3	79,613,011 (GRCm39)	missense	probably damaging	1.00
Z1177:Rxfp1	UTSW	3	79,559,674 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CACGGACATTGATTTTGTTTGC -3'
(R):5'- AACTTCGCGATTCACTGCC -3'

Sequencing Primer
(F):5'- CGGACATTGATTTTGTTTGCAATACC -3'
(R):5'- CGCGATTCACTGCCTTATTTTAGAGG -3'

Posted On

2015-06-24