Incidental Mutation 'R4320:Septin1'
ID 323775
Institutional Source Beutler Lab
Gene Symbol Septin1
Ensembl Gene ENSMUSG00000000486
Gene Name septin 1
Synonyms Sept1, Diff6, PNUTL3
MMRRC Submission 041661-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.251) question?
Stock # R4320 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 126813619-126832302 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 126816200 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 77 (P77S)
Ref Sequence ENSEMBL: ENSMUSP00000145906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032910] [ENSMUST00000106313] [ENSMUST00000106314] [ENSMUST00000127710] [ENSMUST00000133913] [ENSMUST00000142356] [ENSMUST00000152267] [ENSMUST00000206772] [ENSMUST00000206204]
AlphaFold P42209
Predicted Effect probably benign
Transcript: ENSMUST00000032910
SMART Domains Protein: ENSMUSP00000032910
Gene: ENSMUSG00000030672

DomainStartEndE-ValueType
EFh 29 57 9.77e-5 SMART
EFh 99 127 4.45e1 SMART
Blast:EFh 135 163 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106313
AA Change: P77S

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101920
Gene: ENSMUSG00000000486
AA Change: P77S

DomainStartEndE-ValueType
Pfam:DUF258 1 74 4.2e-8 PFAM
Pfam:MMR_HSR1 1 200 5.7e-8 PFAM
Pfam:Septin 1 274 5.7e-120 PFAM
coiled coil region 297 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106314
AA Change: P105S

PolyPhen 2 Score 0.404 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101921
Gene: ENSMUSG00000000486
AA Change: P105S

DomainStartEndE-ValueType
Pfam:Septin 22 302 3.9e-124 PFAM
Pfam:MMR_HSR1 27 171 6.2e-9 PFAM
low complexity region 349 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127710
SMART Domains Protein: ENSMUSP00000120915
Gene: ENSMUSG00000030672

DomainStartEndE-ValueType
Pfam:EF-hand_8 7 34 9.7e-3 PFAM
Pfam:EF-hand_1 9 37 1.6e-6 PFAM
Pfam:EF-hand_6 9 38 1.6e-6 PFAM
Pfam:EF-hand_8 21 54 5.1e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138541
Predicted Effect probably damaging
Transcript: ENSMUST00000133913
AA Change: P77S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000142356
AA Change: P77S

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114468
Gene: ENSMUSG00000000486
AA Change: P77S

DomainStartEndE-ValueType
Pfam:DUF258 1 74 1.4e-8 PFAM
Pfam:MMR_HSR1 1 172 1.4e-8 PFAM
Pfam:Septin 1 186 3.1e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152267
AA Change: P105S

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143222
Predicted Effect probably benign
Transcript: ENSMUST00000206772
Predicted Effect probably benign
Transcript: ENSMUST00000206204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139613
Meta Mutation Damage Score 0.1259 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,740,076 (GRCm39) V826I possibly damaging Het
Arid4a T A 12: 71,116,769 (GRCm39) I609N possibly damaging Het
Asb13 G T 13: 3,695,012 (GRCm39) R160L possibly damaging Het
Brix1 A T 15: 10,483,398 (GRCm39) M91K probably damaging Het
Ccdc191 A G 16: 43,767,872 (GRCm39) E624G probably damaging Het
Cdh10 A G 15: 18,985,251 (GRCm39) D305G probably benign Het
Daxx T C 17: 34,130,393 (GRCm39) L136P probably damaging Het
Fmo1 A T 1: 162,661,200 (GRCm39) L361Q probably damaging Het
Ggcx A G 6: 72,405,803 (GRCm39) S545G probably benign Het
Gm5114 T G 7: 39,057,051 (GRCm39) Y856S probably damaging Het
Grk5 C T 19: 61,080,383 (GRCm39) R576* probably null Het
Hipk3 C A 2: 104,276,916 (GRCm39) V388L probably damaging Het
Htr1f T C 16: 64,747,050 (GRCm39) I81V possibly damaging Het
Kprp G A 3: 92,732,163 (GRCm39) R296W probably damaging Het
Mtf2 T A 5: 108,234,891 (GRCm39) C3S probably damaging Het
Mtmr3 T C 11: 4,437,947 (GRCm39) R836G probably benign Het
Ntrk2 A G 13: 59,007,960 (GRCm39) N241D possibly damaging Het
Or12j2 T A 7: 139,916,219 (GRCm39) I148N possibly damaging Het
Or2y1f G A 11: 49,184,503 (GRCm39) M118I probably damaging Het
Or7g25 A C 9: 19,160,052 (GRCm39) I214M probably damaging Het
Or7g28 G T 9: 19,272,254 (GRCm39) Y132* probably null Het
Orc1 G A 4: 108,445,973 (GRCm39) M30I probably benign Het
Pax2 T A 19: 44,823,838 (GRCm39) F366I probably damaging Het
Pira13 A G 7: 3,825,754 (GRCm39) S372P possibly damaging Het
Plekha5 A G 6: 140,489,543 (GRCm39) K316E possibly damaging Het
Ppp4r4 T A 12: 103,564,502 (GRCm39) N8K probably damaging Het
Rnf125 G A 18: 21,110,817 (GRCm39) R25K probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Sostdc1 C A 12: 36,367,419 (GRCm39) S198R probably benign Het
Sox6 A G 7: 115,179,798 (GRCm39) probably null Het
Spef2 A T 15: 9,679,429 (GRCm39) I636K possibly damaging Het
Stat4 A G 1: 52,113,866 (GRCm39) N192S probably benign Het
Thoc1 A G 18: 9,960,493 (GRCm39) H66R probably benign Het
Tpr A G 1: 150,299,325 (GRCm39) E1101G possibly damaging Het
Trpa1 G T 1: 14,944,676 (GRCm39) H1023N probably benign Het
Tsen15 A T 1: 152,259,460 (GRCm39) D66E probably damaging Het
Tssk3 A G 4: 129,382,994 (GRCm39) V226A possibly damaging Het
Ufl1 T A 4: 25,278,601 (GRCm39) probably null Het
Usp3 A G 9: 66,437,530 (GRCm39) C258R possibly damaging Het
Vmn2r117 TC T 17: 23,698,487 (GRCm39) probably null Het
Other mutations in Septin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0675:Septin1 UTSW 7 126,816,171 (GRCm39) missense probably damaging 0.99
R1375:Septin1 UTSW 7 126,817,333 (GRCm39) missense probably damaging 1.00
R1627:Septin1 UTSW 7 126,817,230 (GRCm39) critical splice acceptor site probably null
R1886:Septin1 UTSW 7 126,813,937 (GRCm39) unclassified probably benign
R2409:Septin1 UTSW 7 126,815,143 (GRCm39) critical splice acceptor site probably null
R3872:Septin1 UTSW 7 126,814,447 (GRCm39) unclassified probably benign
R4321:Septin1 UTSW 7 126,816,200 (GRCm39) missense probably damaging 1.00
R4323:Septin1 UTSW 7 126,816,200 (GRCm39) missense probably damaging 1.00
R4864:Septin1 UTSW 7 126,816,064 (GRCm39) unclassified probably benign
R5605:Septin1 UTSW 7 126,814,598 (GRCm39) missense probably damaging 1.00
R6838:Septin1 UTSW 7 126,815,894 (GRCm39) missense probably benign 0.01
R6870:Septin1 UTSW 7 126,816,876 (GRCm39) missense probably benign 0.25
R7030:Septin1 UTSW 7 126,816,157 (GRCm39) missense probably benign 0.12
R7494:Septin1 UTSW 7 126,814,122 (GRCm39) missense probably damaging 0.98
R7797:Septin1 UTSW 7 126,813,937 (GRCm39) missense unknown
R8002:Septin1 UTSW 7 126,815,074 (GRCm39) missense probably damaging 1.00
R9190:Septin1 UTSW 7 126,816,092 (GRCm39) missense probably benign 0.11
X0021:Septin1 UTSW 7 126,814,525 (GRCm39) missense possibly damaging 0.94
Z1177:Septin1 UTSW 7 126,816,074 (GRCm39) missense possibly damaging 0.84
Z1177:Septin1 UTSW 7 126,815,135 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTACTGAGCTTTCTCCAGCC -3'
(R):5'- AATCTAGCCCAAAGTATCCAGTG -3'

Sequencing Primer
(F):5'- GAGCTTTCTCCAGCCTCCCC -3'
(R):5'- AGCCATGGTGTCACATTAGC -3'
Posted On 2015-06-24