Incidental Mutation 'R4320:Brix1'
ID323789
Institutional Source Beutler Lab
Gene Symbol Brix1
Ensembl Gene ENSMUSG00000022247
Gene NameBRX1, biogenesis of ribosomes
Synonyms1110064N10Rik, Bxdc2
MMRRC Submission 041661-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R4320 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location10474779-10485947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10483312 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 91 (M91K)
Ref Sequence ENSEMBL: ENSMUSP00000127437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022855] [ENSMUST00000022856] [ENSMUST00000100775] [ENSMUST00000168408] [ENSMUST00000168761] [ENSMUST00000169050] [ENSMUST00000169519] [ENSMUST00000170100]
Predicted Effect probably damaging
Transcript: ENSMUST00000022855
AA Change: M85K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022855
Gene: ENSMUSG00000022247
AA Change: M85K

DomainStartEndE-ValueType
Brix 63 243 3.62e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022856
SMART Domains Protein: ENSMUSP00000022856
Gene: ENSMUSG00000022248

DomainStartEndE-ValueType
Pfam:Rad1 16 257 2.2e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100775
SMART Domains Protein: ENSMUSP00000098338
Gene: ENSMUSG00000022248

DomainStartEndE-ValueType
Pfam:Rad1 16 235 5.5e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168408
SMART Domains Protein: ENSMUSP00000132747
Gene: ENSMUSG00000022248

DomainStartEndE-ValueType
Pfam:Rad1 16 67 1.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168690
SMART Domains Protein: ENSMUSP00000132283
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Brix 22 147 5.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168761
SMART Domains Protein: ENSMUSP00000130602
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Blast:Brix 10 51 5e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000169050
AA Change: M91K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127437
Gene: ENSMUSG00000022247
AA Change: M91K

DomainStartEndE-ValueType
Pfam:Brix 72 154 8.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169519
SMART Domains Protein: ENSMUSP00000126645
Gene: ENSMUSG00000022248

DomainStartEndE-ValueType
Pfam:Rad1 16 133 9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170100
SMART Domains Protein: ENSMUSP00000128601
Gene: ENSMUSG00000022248

DomainStartEndE-ValueType
Pfam:Rad1 1 161 1.3e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170531
Meta Mutation Damage Score 0.36 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,246 V826I possibly damaging Het
Arid4a T A 12: 71,069,995 I609N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdh10 A G 15: 18,985,165 D305G probably benign Het
Daxx T C 17: 33,911,419 L136P probably damaging Het
Fmo1 A T 1: 162,833,631 L361Q probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm5114 T G 7: 39,407,627 Y856S probably damaging Het
Grk5 C T 19: 61,091,945 R576* probably null Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Htr1f T C 16: 64,926,687 I81V possibly damaging Het
Kprp G A 3: 92,824,856 R296W probably damaging Het
Mtf2 T A 5: 108,087,025 C3S probably damaging Het
Mtmr3 T C 11: 4,487,947 R836G probably benign Het
Ntrk2 A G 13: 58,860,146 N241D possibly damaging Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Olfr527 T A 7: 140,336,306 I148N possibly damaging Het
Olfr843 A C 9: 19,248,756 I214M probably damaging Het
Olfr846 G T 9: 19,360,958 Y132* probably null Het
Orc1 G A 4: 108,588,776 M30I probably benign Het
Pax2 T A 19: 44,835,399 F366I probably damaging Het
Plekha5 A G 6: 140,543,817 K316E possibly damaging Het
Ppp4r4 T A 12: 103,598,243 N8K probably damaging Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sept1 G A 7: 127,217,028 P77S probably damaging Het
Sostdc1 C A 12: 36,317,420 S198R probably benign Het
Sox6 A G 7: 115,580,563 probably null Het
Spef2 A T 15: 9,679,343 I636K possibly damaging Het
Stat4 A G 1: 52,074,707 N192S probably benign Het
Thoc1 A G 18: 9,960,493 H66R probably benign Het
Tpr A G 1: 150,423,574 E1101G possibly damaging Het
Trpa1 G T 1: 14,874,452 H1023N probably benign Het
Tsen15 A T 1: 152,383,709 D66E probably damaging Het
Tssk3 A G 4: 129,489,201 V226A possibly damaging Het
Ufl1 T A 4: 25,278,601 probably null Het
Usp3 A G 9: 66,530,248 C258R possibly damaging Het
Vmn2r117 TC T 17: 23,479,513 probably null Het
Other mutations in Brix1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03136:Brix1 APN 15 10478766 missense probably damaging 0.97
R1266:Brix1 UTSW 15 10478761 missense probably damaging 1.00
R4276:Brix1 UTSW 15 10481747 missense possibly damaging 0.60
R4824:Brix1 UTSW 15 10485742 missense possibly damaging 0.90
R4902:Brix1 UTSW 15 10483292 splice site probably null
R6018:Brix1 UTSW 15 10476589 missense probably benign 0.26
R6019:Brix1 UTSW 15 10476589 missense probably benign 0.26
R6021:Brix1 UTSW 15 10476589 missense probably benign 0.26
R6022:Brix1 UTSW 15 10476589 missense probably benign 0.26
R7203:Brix1 UTSW 15 10483292 splice site probably null
R7218:Brix1 UTSW 15 10483292 splice site probably null
R7522:Brix1 UTSW 15 10476590 missense probably damaging 1.00
X0023:Brix1 UTSW 15 10478686 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACACCTGAAAGAGTGAACTTTTG -3'
(R):5'- TTGGAGACTTGACGACTGTC -3'

Sequencing Primer
(F):5'- TTTGAGACAGGGTCCCTAAACTG -3'
(R):5'- TGTCAGAAACACACCAAGTATGTTC -3'
Posted On2015-06-24