Incidental Mutation 'R4321:Lonp2'
ID323831
Institutional Source Beutler Lab
Gene Symbol Lonp2
Ensembl Gene ENSMUSG00000047866
Gene Namelon peptidase 2, peroxisomal
Synonyms1300002A08Rik
MMRRC Submission 041662-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R4321 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location86624043-86723873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86665728 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 474 (H474R)
Ref Sequence ENSEMBL: ENSMUSP00000118737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034141] [ENSMUST00000121673] [ENSMUST00000122188] [ENSMUST00000155433] [ENSMUST00000163987]
Predicted Effect probably damaging
Transcript: ENSMUST00000034141
AA Change: H474R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034141
Gene: ENSMUSG00000047866
AA Change: H474R

DomainStartEndE-ValueType
Pfam:LON_substr_bdg 12 220 1e-24 PFAM
low complexity region 243 255 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
AAA 367 512 1.59e-10 SMART
low complexity region 538 545 N/A INTRINSIC
Pfam:Lon_C 628 837 1.6e-83 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121673
AA Change: H54R

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113381
Gene: ENSMUSG00000047866
AA Change: H54R

DomainStartEndE-ValueType
Pfam:AAA 1 93 8.7e-10 PFAM
low complexity region 118 125 N/A INTRINSIC
Pfam:Lon_C 208 417 3.2e-85 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000122188
AA Change: H332R
SMART Domains Protein: ENSMUSP00000113834
Gene: ENSMUSG00000047866
AA Change: H332R

DomainStartEndE-ValueType
Pfam:LON 12 224 9e-17 PFAM
AAA 225 370 1.59e-10 SMART
low complexity region 396 403 N/A INTRINSIC
Pfam:Lon_C 486 695 1.5e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124911
Predicted Effect probably damaging
Transcript: ENSMUST00000155433
AA Change: H474R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118737
Gene: ENSMUSG00000047866
AA Change: H474R

DomainStartEndE-ValueType
Pfam:LON 12 220 3.3e-26 PFAM
low complexity region 243 255 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
AAA 367 512 1.59e-10 SMART
low complexity region 538 545 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163987
AA Change: H54R

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127938
Gene: ENSMUSG00000047866
AA Change: H54R

DomainStartEndE-ValueType
Pfam:AAA 1 93 8.7e-10 PFAM
low complexity region 118 125 N/A INTRINSIC
Pfam:Lon_C 208 417 3.2e-85 PFAM
Meta Mutation Damage Score 0.348 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (56/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, peroxisomes function primarily to catalyze fatty acid beta-oxidation and, as a by-product, produce hydrogen peroxide and superoxide. The protein encoded by this gene is an ATP-dependent protease that likely plays a role in maintaining overall peroxisome homeostasis as well as proteolytically degrading peroxisomal proteins damaged by oxidation. The protein has an N-terminal Lon N substrate recognition domain, an ATPase domain, a proteolytic domain, and, in some isoforms, a C-terminal peroxisome targeting sequence. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A T 10: 29,224,891 D420V probably damaging Het
AI464131 C T 4: 41,498,767 V288I probably benign Het
Als2 A C 1: 59,167,454 probably benign Het
Ankrd9 A G 12: 110,976,640 L287P probably damaging Het
Bbof1 A T 12: 84,427,128 R411* probably null Het
Camta2 A T 11: 70,678,325 L598Q probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Cep85 G A 4: 134,132,285 T689I probably damaging Het
Clvs1 T C 4: 9,282,029 probably benign Het
Cpped1 T C 16: 11,887,746 T65A probably benign Het
Daxx T C 17: 33,911,406 Y132H possibly damaging Het
Dock7 T C 4: 99,072,454 E279G probably damaging Het
Dok7 A T 5: 35,079,797 probably benign Het
Doxl2 T A 6: 48,976,522 D460E probably damaging Het
Dthd1 A T 5: 62,818,690 I236F probably damaging Het
Egf A G 3: 129,706,134 C285R probably damaging Het
Epha4 T A 1: 77,507,213 probably null Het
Fbxw13 A C 9: 109,181,435 I378M probably benign Het
Gaa A T 11: 119,270,137 N2I probably benign Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Golga4 A G 9: 118,556,435 E847G probably damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Ibtk T C 9: 85,735,072 D149G possibly damaging Het
Ice1 A T 13: 70,603,110 V1619E possibly damaging Het
Itpr3 A G 17: 27,111,974 E1752G probably benign Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kprp G A 3: 92,824,856 R296W probably damaging Het
Lama1 G A 17: 67,771,083 G1171D probably benign Het
Mark1 G T 1: 184,898,674 D746E possibly damaging Het
Mlxipl C T 5: 135,135,450 Q167* probably null Het
Myo3a A T 2: 22,267,155 N162Y probably damaging Het
Myo5a T G 9: 75,217,530 V1787G probably damaging Het
Nrxn3 A T 12: 90,199,231 E227V probably damaging Het
Orc1 G A 4: 108,588,776 M30I probably benign Het
Rufy2 A G 10: 62,982,680 D5G probably damaging Het
Rufy4 A T 1: 74,132,784 D222V possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sept1 G A 7: 127,217,028 P77S probably damaging Het
Slamf1 T C 1: 171,775,126 probably null Het
Sox6 A G 7: 115,580,563 probably null Het
Spef2 A T 15: 9,679,343 I636K possibly damaging Het
Tshz2 T A 2: 169,885,545 I218N possibly damaging Het
Txnl1 T C 18: 63,679,490 T78A possibly damaging Het
Ulk4 T G 9: 121,073,996 R1138S probably benign Het
Vamp8 A C 6: 72,385,553 V88G possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfp850 A C 7: 27,989,400 F461C probably damaging Het
Other mutations in Lonp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Lonp2 APN 8 86633972 missense probably damaging 1.00
IGL00990:Lonp2 APN 8 86641533 splice site probably benign
IGL01654:Lonp2 APN 8 86714086 missense probably damaging 1.00
IGL02021:Lonp2 APN 8 86708971 missense probably benign 0.00
IGL02165:Lonp2 APN 8 86709026 missense probably damaging 1.00
IGL02309:Lonp2 APN 8 86634863 missense probably damaging 1.00
IGL02355:Lonp2 APN 8 86624246 missense probably benign 0.17
IGL02362:Lonp2 APN 8 86624246 missense probably benign 0.17
IGL02365:Lonp2 APN 8 86716365 missense possibly damaging 0.69
IGL02374:Lonp2 APN 8 86709045 missense probably damaging 0.97
IGL02440:Lonp2 APN 8 86624185 start codon destroyed probably null 0.98
R0083:Lonp2 UTSW 8 86716355 missense probably benign 0.13
R0108:Lonp2 UTSW 8 86716355 missense probably benign 0.13
R0108:Lonp2 UTSW 8 86716355 missense probably benign 0.13
R0129:Lonp2 UTSW 8 86634890 missense probably damaging 0.99
R0302:Lonp2 UTSW 8 86637991 missense possibly damaging 0.94
R0433:Lonp2 UTSW 8 86633954 missense probably damaging 1.00
R1148:Lonp2 UTSW 8 86636540 missense probably benign 0.00
R1148:Lonp2 UTSW 8 86636540 missense probably benign 0.00
R1413:Lonp2 UTSW 8 86641584 missense probably damaging 1.00
R1589:Lonp2 UTSW 8 86673072 splice site probably benign
R1635:Lonp2 UTSW 8 86713450 missense possibly damaging 0.78
R1654:Lonp2 UTSW 8 86631450 missense probably damaging 0.99
R2033:Lonp2 UTSW 8 86708942 missense possibly damaging 0.77
R2062:Lonp2 UTSW 8 86665775 missense probably damaging 0.99
R2065:Lonp2 UTSW 8 86665775 missense probably damaging 0.99
R2066:Lonp2 UTSW 8 86665775 missense probably damaging 0.99
R2068:Lonp2 UTSW 8 86665775 missense probably damaging 0.99
R4713:Lonp2 UTSW 8 86713315 missense probably damaging 0.98
R4750:Lonp2 UTSW 8 86631502 missense probably benign 0.09
R5790:Lonp2 UTSW 8 86631490 missense probably benign 0.24
R5854:Lonp2 UTSW 8 86673071 critical splice donor site probably null
R5884:Lonp2 UTSW 8 86641626 missense probably damaging 1.00
R6025:Lonp2 UTSW 8 86713373 missense probably damaging 1.00
R6236:Lonp2 UTSW 8 86636587 nonsense probably null
R6481:Lonp2 UTSW 8 86634908 missense possibly damaging 0.69
R6534:Lonp2 UTSW 8 86716458 missense probably benign 0.00
R6805:Lonp2 UTSW 8 86709096 missense probably benign
R6983:Lonp2 UTSW 8 86624248 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAATAGAATGTGTGGCATG -3'
(R):5'- GCATGACTGACTTTAAAGGGTG -3'

Sequencing Primer
(F):5'- AGGATTTAGAATATGAGGTGGTCAG -3'
(R):5'- CTGACTTTAAAGGGTGTGCTCAAAAG -3'
Posted On2015-06-24