Incidental Mutation 'R4322:Lilrb4a'
ID323876
Institutional Source Beutler Lab
Gene Symbol Lilrb4a
Ensembl Gene ENSMUSG00000112148
Gene Nameleukocyte immunoglobulin-like receptor, subfamily B, member 4A
SynonymsLilrb4, CD85K, ILT3, HM18, Gp49b
MMRRC Submission 041093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R4322 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location51490956-51496611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51491611 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 83 (F83S)
Ref Sequence ENSEMBL: ENSMUSP00000151694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078778] [ENSMUST00000102894] [ENSMUST00000217705] [ENSMUST00000217706] [ENSMUST00000218123] [ENSMUST00000218617] [ENSMUST00000219696] [ENSMUST00000219960] [ENSMUST00000220182] [ENSMUST00000220226]
Predicted Effect probably damaging
Transcript: ENSMUST00000078778
AA Change: F83S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077833
Gene: ENSMUSG00000112148
AA Change: F83S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102894
SMART Domains Protein: ENSMUSP00000099958
Gene: ENSMUSG00000112023

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCOP:d1nkr_2 24 118 3e-14 SMART
Blast:IG_like 28 118 5e-49 BLAST
Pfam:Ig_3 123 200 6.5e-8 PFAM
Pfam:Ig_2 123 218 5.9e-8 PFAM
Pfam:ig 127 211 8.4e-9 PFAM
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105481
AA Change: F83S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101121
Gene: ENSMUSG00000062593
AA Change: F83S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105482
AA Change: F83S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101122
Gene: ENSMUSG00000062593
AA Change: F83S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217705
Predicted Effect probably damaging
Transcript: ENSMUST00000217706
AA Change: F83S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000218123
AA Change: F83S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218413
Predicted Effect probably benign
Transcript: ENSMUST00000218617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219388
Predicted Effect probably damaging
Transcript: ENSMUST00000219696
AA Change: F83S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219848
Predicted Effect probably benign
Transcript: ENSMUST00000219960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220166
Predicted Effect probably damaging
Transcript: ENSMUST00000220182
AA Change: F83S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000220226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220402
Meta Mutation Damage Score 0.4 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 94% (48/51)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased sensitivity to IgE-dependent passive cutaneous anaphylaxis and a reduced threshold for antigen challenge in active cutaneous anaphylaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt2 G A 4: 154,667,244 A145V probably damaging Het
Allc C A 12: 28,554,024 L353F probably benign Het
Alx3 C T 3: 107,595,375 P67L probably benign Het
Arhgef10l C A 4: 140,542,726 G882V probably benign Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Bdp1 T A 13: 100,092,223 N299I probably damaging Het
Ccdc80 G T 16: 45,095,588 V236L probably damaging Het
Cdhr2 A T 13: 54,733,721 I1085L probably benign Het
Csn2 C T 5: 87,698,027 probably null Het
Dnajb14 G A 3: 137,885,299 G54S probably damaging Het
Fam35a G T 14: 34,259,675 T502K probably damaging Het
Fyb T A 15: 6,580,819 L291Q possibly damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
Gm12250 G A 11: 58,188,300 noncoding transcript Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Kng1 A C 16: 23,079,520 M557L probably benign Het
Lmcd1 A G 6: 112,315,763 E192G possibly damaging Het
Lrp2 C A 2: 69,425,991 E4602* probably null Het
Mc4r T C 18: 66,859,050 R331G probably benign Het
Mybpc3 A G 2: 91,123,961 D393G possibly damaging Het
Olfr1257 A G 2: 89,881,734 K303E probably benign Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Olfr494 C T 7: 108,368,348 P286L probably damaging Het
Orc1 G A 4: 108,588,776 M30I probably benign Het
Pot1a T C 6: 25,745,930 T591A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sh3rf2 A T 18: 42,111,399 H310L probably damaging Het
Srgap1 T C 10: 121,869,806 K238E probably damaging Het
Ssc5d C T 7: 4,928,450 R219C probably damaging Het
Them5 C A 3: 94,346,156 H158N probably damaging Het
Vmn1r203 A T 13: 22,524,238 N63I probably damaging Het
Vps41 T A 13: 18,823,790 F264L probably damaging Het
Vtn A T 11: 78,500,090 probably benign Het
Other mutations in Lilrb4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Lilrb4a APN 10 51494065 missense probably benign 0.42
IGL02057:Lilrb4a APN 10 51492007 missense possibly damaging 0.81
IGL02386:Lilrb4a APN 10 51491226 nonsense probably null
IGL02999:Lilrb4a APN 10 51494143 missense probably damaging 1.00
IGL03292:Lilrb4a APN 10 51494846 unclassified probably null
IGL03382:Lilrb4a APN 10 51491520 missense probably benign 0.10
R0276:Lilrb4a UTSW 10 51491581 missense probably benign 0.01
R0470:Lilrb4a UTSW 10 51494827 missense possibly damaging 0.87
R1459:Lilrb4a UTSW 10 51491587 missense probably benign 0.44
R1675:Lilrb4a UTSW 10 51496185 missense probably benign 0.37
R1819:Lilrb4a UTSW 10 51496028 missense probably damaging 1.00
R1914:Lilrb4a UTSW 10 51491949 missense probably benign 0.04
R2265:Lilrb4a UTSW 10 51491537 nonsense probably null
R2338:Lilrb4a UTSW 10 51491700 missense probably benign 0.13
R2884:Lilrb4a UTSW 10 51491613 missense probably benign 0.01
R2886:Lilrb4a UTSW 10 51491613 missense probably benign 0.01
R4624:Lilrb4a UTSW 10 51491488 missense probably damaging 1.00
R4923:Lilrb4a UTSW 10 51492043 missense possibly damaging 0.67
R5001:Lilrb4a UTSW 10 51491420 splice site probably null
R5262:Lilrb4a UTSW 10 51493207 critical splice donor site probably null
R6224:Lilrb4a UTSW 10 51491649 missense probably damaging 1.00
R7447:Lilrb4a UTSW 10 51491053 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGGAAGATGTTCAGGGCCTTTG -3'
(R):5'- TGGACTCTGAGAGAAGAGCTC -3'

Sequencing Primer
(F):5'- GGGCCTTTGATTTCTTCACAGGAC -3'
(R):5'- CCTGGAAAATAGATCTCCTTCTGAGG -3'
Posted On2015-06-24