Incidental Mutation 'R4324:Aqp6'
List |< first << previous [record 85 of 1308] next >> last >|
ID323978
Institutional Source Beutler Lab
Gene Symbol Aqp6
Ensembl Gene ENSMUSG00000043144
Gene Nameaquaporin 6
Synonyms
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location99601400-99605477 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) G to A at 99601410 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000154934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023754] [ENSMUST00000230075]
Predicted Effect probably null
Transcript: ENSMUST00000023754
AA Change: M1I

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000023754
Gene: ENSMUSG00000043144
AA Change: M1I

DomainStartEndE-ValueType
Pfam:MIP 17 228 2.2e-67 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000230075
AA Change: M1I

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an aquaporin protein, which functions as a water channel in cells. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein (MIP or AQP0). This protein is specific for the kidney. This gene and related family members AQP0, AQP2, and AQP5 reside in a cluster on chromosome 12q13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Aqp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Aqp6 APN 15 99604278 missense probably benign 0.01
IGL02827:Aqp6 APN 15 99603011 missense probably damaging 1.00
R1482:Aqp6 UTSW 15 99604307 makesense probably null
R1708:Aqp6 UTSW 15 99602662 missense possibly damaging 0.92
R5756:Aqp6 UTSW 15 99602742 missense probably damaging 0.98
R5974:Aqp6 UTSW 15 99601436 missense probably benign 0.12
R6773:Aqp6 UTSW 15 99602677 missense probably damaging 0.98
X0025:Aqp6 UTSW 15 99601505 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTGAGCACTCTGAACCTC -3'
(R):5'- CAGATTGAAGGTGATGGCGATC -3'

Sequencing Primer
(F):5'- CCCATGAATCTGAGCAGCTTG -3'
(R):5'- TGATGGCGATCTGGAGCAC -3'
Posted On2015-06-24