Mutagenetix > Incidental Mutation

Incidental Mutation 'R4305:Krt1'

324008

Institutional Source

Beutler Lab

Gene Symbol

Krt1

Ensembl Gene

ENSMUSG00000046834

Gene Name

keratin 1

Synonyms

Krt2-1, Krt-2.1

MMRRC Submission

041091-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.454) question?

Stock #

R4305 (G1)

Quality Score

174

Status

Validated

Chromosome

Chromosomal Location

101753861-101759221 bp(-) (GRCm39)

Type of Mutation

small deletion (10 aa in frame mutation)

DNA Base Change (assembly)

AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC at 101758813 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000023790 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023790]

AlphaFold

P04104

Predicted Effect

probably benign
Transcript: ENSMUST00000023790

SMART Domains

Protein: ENSMUSP00000023790
Gene: ENSMUSG00000046834

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	19	184	7.5e-35	PFAM
Filament	187	500	1.02e-154	SMART
Pfam:Keratin_2_tail	501	633	7.6e-29	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230798

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231047

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

92% (36/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the spinous and granular layers of the epidermis with family member KRT10 and mutations in these genes have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a dominant mutation exhibit significant blistering and skin erosions at birth and develop severe hyperkeratosis as adults. Mice homozygous for the dominant mutation also exhibit blistering, and die before weaning age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	C	A	1: 12,042,300 (GRCm39)	S440*	probably null	Het
Abl2	T	A	1: 156,469,133 (GRCm39)	M695K	probably damaging	Het
Asap2	T	C	12: 21,279,482 (GRCm39)	I426T	probably damaging	Het
Atxn7l1	T	C	12: 33,391,991 (GRCm39)	M93T	probably damaging	Het
Ccr5	T	C	9: 123,925,111 (GRCm39)	L238P	possibly damaging	Het
Cd27	A	G	6: 125,211,633 (GRCm39)	V98A	probably benign	Het
Ceacam23	T	A	7: 17,639,118 (GRCm39)	Y372N	probably benign	Het
Cfap47	C	G	X: 78,541,635 (GRCm39)	K469N	probably damaging	Het
Chrdl2	A	G	7: 99,671,229 (GRCm39)	T116A	probably damaging	Het
Epha6	T	C	16: 60,346,883 (GRCm39)		probably null	Het
Garin1b	A	G	6: 29,326,611 (GRCm39)	S243G	probably damaging	Het
Gart	T	C	16: 91,430,880 (GRCm39)	E394G	possibly damaging	Het
Lpar6	G	A	14: 73,476,381 (GRCm39)	R114Q	probably damaging	Het
Med23	G	T	10: 24,780,168 (GRCm39)	E573*	probably null	Het
Mtch2	A	G	2: 90,689,827 (GRCm39)	I183V	probably benign	Het
Nlrp3	C	T	11: 59,438,836 (GRCm39)	R138*	probably null	Het
Notch1	T	C	2: 26,367,936 (GRCm39)	D657G	probably damaging	Het
Or4k37	A	G	2: 111,159,643 (GRCm39)	D293G	probably null	Het
Rbm20	A	G	19: 53,831,691 (GRCm39)	S642G	probably damaging	Het
Tex11	C	A	X: 99,977,021 (GRCm39)	A487S	possibly damaging	Het
Ttn	T	C	2: 76,748,681 (GRCm39)	S4123G	probably benign	Het
Ugt3a1	A	C	15: 9,306,360 (GRCm39)	S170R	possibly damaging	Het
Vmn2r71	G	T	7: 85,273,360 (GRCm39)	D725Y	probably damaging	Het
Vps9d1	G	T	8: 123,974,976 (GRCm39)		probably benign	Het
Yeats2	A	G	16: 20,027,172 (GRCm39)	T808A	probably damaging	Het
Zdhhc4	C	T	5: 143,310,099 (GRCm39)		probably benign	Het

Other mutations in Krt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01133:Krt1	APN	15	101,756,628 (GRCm39)	missense	probably damaging	1.00
IGL01478:Krt1	APN	15	101,754,721 (GRCm39)	splice site	probably benign
IGL01919:Krt1	APN	15	101,754,811 (GRCm39)	missense	unknown
IGL01970:Krt1	APN	15	101,755,299 (GRCm39)	missense	possibly damaging	0.95
IGL02207:Krt1	APN	15	101,757,051 (GRCm39)	missense	possibly damaging	0.94
IGL02643:Krt1	APN	15	101,755,479 (GRCm39)	missense	probably benign	0.26
R0445:Krt1	UTSW	15	101,756,056 (GRCm39)	missense	probably damaging	1.00
R0683:Krt1	UTSW	15	101,758,901 (GRCm39)	missense	unknown
R1006:Krt1	UTSW	15	101,756,326 (GRCm39)	missense	possibly damaging	0.96
R1163:Krt1	UTSW	15	101,756,600 (GRCm39)	nonsense	probably null
R1217:Krt1	UTSW	15	101,757,416 (GRCm39)	missense	possibly damaging	0.90
R1325:Krt1	UTSW	15	101,756,641 (GRCm39)	splice site	probably null
R1965:Krt1	UTSW	15	101,757,427 (GRCm39)	missense	probably benign	0.13
R1966:Krt1	UTSW	15	101,757,427 (GRCm39)	missense	probably benign	0.13
R2101:Krt1	UTSW	15	101,754,622 (GRCm39)	missense	unknown
R2302:Krt1	UTSW	15	101,754,622 (GRCm39)	missense	unknown
R2697:Krt1	UTSW	15	101,755,364 (GRCm39)	missense	probably damaging	1.00
R3034:Krt1	UTSW	15	101,759,068 (GRCm39)	missense	unknown
R3079:Krt1	UTSW	15	101,754,622 (GRCm39)	missense	unknown
R3080:Krt1	UTSW	15	101,754,622 (GRCm39)	missense	unknown
R3891:Krt1	UTSW	15	101,758,847 (GRCm39)	missense	unknown
R3892:Krt1	UTSW	15	101,758,847 (GRCm39)	missense	unknown
R4180:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R4334:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R4597:Krt1	UTSW	15	101,756,063 (GRCm39)	missense	possibly damaging	0.90
R4625:Krt1	UTSW	15	101,754,622 (GRCm39)	missense	unknown
R4626:Krt1	UTSW	15	101,754,622 (GRCm39)	missense	unknown
R4628:Krt1	UTSW	15	101,754,622 (GRCm39)	missense	unknown
R4629:Krt1	UTSW	15	101,754,622 (GRCm39)	missense	unknown
R4630:Krt1	UTSW	15	101,754,622 (GRCm39)	missense	unknown
R4631:Krt1	UTSW	15	101,754,622 (GRCm39)	missense	unknown
R4632:Krt1	UTSW	15	101,754,622 (GRCm39)	missense	unknown
R4633:Krt1	UTSW	15	101,754,622 (GRCm39)	missense	unknown
R4893:Krt1	UTSW	15	101,758,555 (GRCm39)	missense	probably damaging	1.00
R4948:Krt1	UTSW	15	101,754,376 (GRCm39)	missense	unknown
R5193:Krt1	UTSW	15	101,754,357 (GRCm39)	missense	unknown
R5254:Krt1	UTSW	15	101,754,803 (GRCm39)	missense	unknown
R5448:Krt1	UTSW	15	101,757,464 (GRCm39)	nonsense	probably null
R5494:Krt1	UTSW	15	101,759,149 (GRCm39)	missense	unknown
R5567:Krt1	UTSW	15	101,755,340 (GRCm39)	missense	probably benign	0.12
R5570:Krt1	UTSW	15	101,755,340 (GRCm39)	missense	probably benign	0.12
R5869:Krt1	UTSW	15	101,758,566 (GRCm39)	missense	probably damaging	1.00
R6200:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R6224:Krt1	UTSW	15	101,758,702 (GRCm39)	missense	possibly damaging	0.92
R6326:Krt1	UTSW	15	101,758,684 (GRCm39)	missense	probably damaging	1.00
R6517:Krt1	UTSW	15	101,758,702 (GRCm39)	missense	possibly damaging	0.92
R6525:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R6918:Krt1	UTSW	15	101,758,612 (GRCm39)	missense	probably damaging	1.00
R7018:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R7040:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R7110:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R7296:Krt1	UTSW	15	101,759,064 (GRCm39)	missense	unknown
R7368:Krt1	UTSW	15	101,755,307 (GRCm39)	missense	probably damaging	1.00
R7549:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R7706:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R8416:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R8418:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R8842:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R8914:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R8964:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R8979:Krt1	UTSW	15	101,755,340 (GRCm39)	missense	probably benign	0.12
R8988:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R9134:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R9248:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R9380:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R9404:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R9430:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R9638:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
R9768:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
RF003:Krt1	UTSW	15	101,758,813 (GRCm39)	small deletion	probably benign
X0067:Krt1	UTSW	15	101,756,190 (GRCm39)	critical splice donor site	probably null
Z1177:Krt1	UTSW	15	101,758,970 (GRCm39)	missense	unknown
Z1177:Krt1	UTSW	15	101,754,451 (GRCm39)	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCAACGTTGAGGGGTTGCAG -3'
(R):5'- GATCCACCAGCAGCTCTATG -3'

Sequencing Primer
(F):5'- CAGAAGGCTTTGGTTGATGGTCAC -3'
(R):5'- AGATTTTCAGGAGGAGGCTTC -3'

Posted On

2015-06-24