Mutagenetix > Incidental Mutation

Incidental Mutation 'R4306:Trip11'

324040

Institutional Source

Beutler Lab

Gene Symbol

Trip11

Ensembl Gene

ENSMUSG00000021188

Gene Name

thyroid hormone receptor interactor 11

Synonyms

3110031G15Rik, TRIP230, 2610511G22Rik, GMAP-210, 6030460N08Rik

MMRRC Submission

041092-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4306 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101800304-101879463 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101853198 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 465 (F465L)

Ref Sequence

ENSEMBL: ENSMUSP00000135669 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000176728] [ENSMUST00000177183] [ENSMUST00000177536]

AlphaFold

E9Q512

Predicted Effect

probably benign
Transcript: ENSMUST00000021605
AA Change: F466L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: F466L

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
coiled coil region	54	130	N/A	INTRINSIC
coiled coil region	167	194	N/A	INTRINSIC
coiled coil region	218	702	N/A	INTRINSIC
coiled coil region	754	990	N/A	INTRINSIC
coiled coil region	1022	1051	N/A	INTRINSIC
coiled coil region	1196	1261	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
coiled coil region	1336	1481	N/A	INTRINSIC
coiled coil region	1547	1657	N/A	INTRINSIC
coiled coil region	1681	1771	N/A	INTRINSIC
low complexity region	1934	1945	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176728

SMART Domains

Protein: ENSMUSP00000134992
Gene: ENSMUSG00000021188

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
Pfam:Orthopox_A5L	48	282	6.5e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177183
AA Change: F181L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: F181L

Domain	Start	End	E-Value	Type
coiled coil region	33	158	N/A	INTRINSIC
coiled coil region	179	417	N/A	INTRINSIC
coiled coil region	469	705	N/A	INTRINSIC
coiled coil region	737	766	N/A	INTRINSIC
coiled coil region	911	976	N/A	INTRINSIC
low complexity region	1025	1037	N/A	INTRINSIC
coiled coil region	1051	1196	N/A	INTRINSIC
coiled coil region	1262	1372	N/A	INTRINSIC
coiled coil region	1396	1486	N/A	INTRINSIC
low complexity region	1649	1660	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177480

Predicted Effect

probably benign
Transcript: ENSMUST00000177536
AA Change: F465L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000135669
Gene: ENSMUSG00000021188
AA Change: F465L

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
coiled coil region	53	129	N/A	INTRINSIC
coiled coil region	166	193	N/A	INTRINSIC
coiled coil region	217	517	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

97% (33/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	C	A	1: 12,042,300 (GRCm39)	S440*	probably null	Het
Chrdl2	A	G	7: 99,671,229 (GRCm39)	T116A	probably damaging	Het
Chst12	T	C	5: 140,510,401 (GRCm39)	F343L	probably damaging	Het
Cpeb2	T	A	5: 43,392,578 (GRCm39)		probably benign	Het
Cyp27b1	A	G	10: 126,886,957 (GRCm39)	D391G	probably benign	Het
Dll3	T	C	7: 28,001,082 (GRCm39)		probably null	Het
Dnah7b	T	A	1: 46,260,932 (GRCm39)	I2030N	probably damaging	Het
Fap	C	T	2: 62,361,051 (GRCm39)		probably null	Het
Frmd4a	C	T	2: 4,337,889 (GRCm39)	R32C	probably benign	Het
Fzd7	T	C	1: 59,523,566 (GRCm39)	V483A	probably damaging	Het
Gpm6a	T	C	8: 55,500,428 (GRCm39)		probably null	Het
Gprc6a	T	C	10: 51,492,735 (GRCm39)	H539R	probably damaging	Het
Irs1	C	T	1: 82,265,685 (GRCm39)	A844T	probably benign	Het
Myo1a	T	G	10: 127,549,950 (GRCm39)	S477A	probably benign	Het
Naga	C	T	15: 82,221,095 (GRCm39)	W67*	probably null	Het
Or51ah3	G	C	7: 103,210,380 (GRCm39)	R232T	possibly damaging	Het
Or51ah3	A	T	7: 103,210,379 (GRCm39)	R232*	probably null	Het
Osbpl1a	T	C	18: 12,952,652 (GRCm39)	E87G	probably benign	Het
Prr27	A	G	5: 87,990,766 (GRCm39)	H126R	probably benign	Het
Rb1	G	A	14: 73,500,135 (GRCm39)	T504I	probably damaging	Het
Rnf144b	A	G	13: 47,396,418 (GRCm39)	N252D	probably damaging	Het
Slit2	T	A	5: 48,460,125 (GRCm39)	N1385K	possibly damaging	Het
Spaca7b	T	A	8: 11,728,590 (GRCm39)	N27I	probably damaging	Het
Tas2r124	A	G	6: 132,731,954 (GRCm39)	I88V	probably benign	Het
Usp31	G	A	7: 121,306,152 (GRCm39)	P109S	possibly damaging	Het
Vmn2r12	A	G	5: 109,233,872 (GRCm39)	L780P	probably damaging	Het
Vmn2r71	G	T	7: 85,273,360 (GRCm39)	D725Y	probably damaging	Het
Zfp459	T	C	13: 67,561,307 (GRCm39)	K47R	probably damaging	Het

Other mutations in Trip11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Trip11	APN	12	101,852,406 (GRCm39)	missense	probably benign	0.37
IGL00484:Trip11	APN	12	101,851,570 (GRCm39)	nonsense	probably null
IGL00972:Trip11	APN	12	101,860,596 (GRCm39)	missense	probably null	1.00
IGL01476:Trip11	APN	12	101,865,170 (GRCm39)	missense	probably damaging	0.96
IGL01591:Trip11	APN	12	101,849,604 (GRCm39)	missense	probably damaging	0.98
IGL01667:Trip11	APN	12	101,845,121 (GRCm39)	missense	probably damaging	1.00
IGL01764:Trip11	APN	12	101,850,890 (GRCm39)	missense	probably damaging	1.00
IGL01789:Trip11	APN	12	101,838,090 (GRCm39)	missense	probably benign	0.05
IGL01814:Trip11	APN	12	101,850,747 (GRCm39)	missense	probably damaging	0.98
IGL01898:Trip11	APN	12	101,851,935 (GRCm39)	missense	probably benign
IGL01924:Trip11	APN	12	101,853,143 (GRCm39)	missense	possibly damaging	0.93
IGL02020:Trip11	APN	12	101,850,572 (GRCm39)	missense	probably damaging	1.00
IGL02475:Trip11	APN	12	101,861,942 (GRCm39)	missense	probably benign	0.01
IGL02544:Trip11	APN	12	101,859,780 (GRCm39)	missense	probably damaging	1.00
IGL02678:Trip11	APN	12	101,849,649 (GRCm39)	missense	probably damaging	0.96
IGL02714:Trip11	APN	12	101,850,260 (GRCm39)	missense	probably damaging	1.00
IGL02718:Trip11	APN	12	101,852,284 (GRCm39)	missense	probably benign	0.24
IGL02904:Trip11	APN	12	101,853,097 (GRCm39)	missense	probably damaging	1.00
IGL03012:Trip11	APN	12	101,850,195 (GRCm39)	missense	probably damaging	1.00
IGL03191:Trip11	APN	12	101,865,184 (GRCm39)	missense	probably damaging	1.00
IGL03327:Trip11	APN	12	101,849,677 (GRCm39)	missense	possibly damaging	0.87
IGL03337:Trip11	APN	12	101,851,278 (GRCm39)	missense	probably damaging	1.00
NA:Trip11	UTSW	12	101,860,580 (GRCm39)	splice site	probably null
R0027:Trip11	UTSW	12	101,851,428 (GRCm39)	missense	probably benign	0.00
R0028:Trip11	UTSW	12	101,851,016 (GRCm39)	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101,850,987 (GRCm39)	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101,850,987 (GRCm39)	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101,850,987 (GRCm39)	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101,850,987 (GRCm39)	missense	probably damaging	1.00
R0505:Trip11	UTSW	12	101,851,931 (GRCm39)	missense	probably damaging	0.98
R0556:Trip11	UTSW	12	101,850,777 (GRCm39)	nonsense	probably null
R0573:Trip11	UTSW	12	101,853,119 (GRCm39)	missense	probably benign	0.02
R0626:Trip11	UTSW	12	101,852,235 (GRCm39)	missense	possibly damaging	0.54
R1519:Trip11	UTSW	12	101,852,419 (GRCm39)	missense	probably benign	0.04
R1530:Trip11	UTSW	12	101,879,026 (GRCm39)	missense	unknown
R1647:Trip11	UTSW	12	101,850,651 (GRCm39)	nonsense	probably null
R1648:Trip11	UTSW	12	101,850,651 (GRCm39)	nonsense	probably null
R1856:Trip11	UTSW	12	101,849,592 (GRCm39)	nonsense	probably null
R2013:Trip11	UTSW	12	101,803,981 (GRCm39)	missense	probably damaging	1.00
R2017:Trip11	UTSW	12	101,851,619 (GRCm39)	missense	probably benign	0.00
R2206:Trip11	UTSW	12	101,839,701 (GRCm39)	missense	probably benign	0.25
R2207:Trip11	UTSW	12	101,839,701 (GRCm39)	missense	probably benign	0.25
R2304:Trip11	UTSW	12	101,865,236 (GRCm39)	missense	possibly damaging	0.58
R2328:Trip11	UTSW	12	101,845,086 (GRCm39)	makesense	probably null
R2513:Trip11	UTSW	12	101,803,986 (GRCm39)	missense	possibly damaging	0.94
R3499:Trip11	UTSW	12	101,859,953 (GRCm39)	missense	possibly damaging	0.87
R4105:Trip11	UTSW	12	101,860,581 (GRCm39)	nonsense	probably null
R4124:Trip11	UTSW	12	101,861,957 (GRCm39)	nonsense	probably null
R4126:Trip11	UTSW	12	101,861,957 (GRCm39)	nonsense	probably null
R4128:Trip11	UTSW	12	101,861,957 (GRCm39)	nonsense	probably null
R4175:Trip11	UTSW	12	101,861,957 (GRCm39)	nonsense	probably null
R4176:Trip11	UTSW	12	101,861,957 (GRCm39)	nonsense	probably null
R4181:Trip11	UTSW	12	101,860,027 (GRCm39)	missense	probably damaging	1.00
R4296:Trip11	UTSW	12	101,852,127 (GRCm39)	nonsense	probably null
R4302:Trip11	UTSW	12	101,860,027 (GRCm39)	missense	probably damaging	1.00
R4342:Trip11	UTSW	12	101,850,575 (GRCm39)	missense	probably damaging	1.00
R4576:Trip11	UTSW	12	101,852,499 (GRCm39)	nonsense	probably null
R4586:Trip11	UTSW	12	101,849,600 (GRCm39)	missense	possibly damaging	0.55
R4634:Trip11	UTSW	12	101,803,875 (GRCm39)	missense	probably damaging	1.00
R4696:Trip11	UTSW	12	101,851,549 (GRCm39)	missense	possibly damaging	0.71
R4792:Trip11	UTSW	12	101,851,705 (GRCm39)	missense	probably benign	0.10
R4903:Trip11	UTSW	12	101,853,065 (GRCm39)	critical splice donor site	probably null
R5001:Trip11	UTSW	12	101,851,169 (GRCm39)	nonsense	probably null
R5017:Trip11	UTSW	12	101,812,879 (GRCm39)	missense	probably benign	0.00
R5227:Trip11	UTSW	12	101,851,179 (GRCm39)	missense	probably damaging	1.00
R5231:Trip11	UTSW	12	101,851,860 (GRCm39)	missense	probably damaging	0.96
R5539:Trip11	UTSW	12	101,851,386 (GRCm39)	missense	probably damaging	0.98
R5754:Trip11	UTSW	12	101,851,924 (GRCm39)	nonsense	probably null
R5755:Trip11	UTSW	12	101,851,924 (GRCm39)	nonsense	probably null
R5890:Trip11	UTSW	12	101,852,231 (GRCm39)	missense	probably damaging	0.99
R5910:Trip11	UTSW	12	101,849,738 (GRCm39)	missense	probably damaging	1.00
R6083:Trip11	UTSW	12	101,856,001 (GRCm39)	missense	probably benign	0.00
R6208:Trip11	UTSW	12	101,865,154 (GRCm39)	missense	probably damaging	1.00
R6216:Trip11	UTSW	12	101,856,859 (GRCm39)	missense	probably benign	0.31
R6315:Trip11	UTSW	12	101,851,837 (GRCm39)	missense	possibly damaging	0.84
R6413:Trip11	UTSW	12	101,851,790 (GRCm39)	missense	probably benign	0.12
R6590:Trip11	UTSW	12	101,851,710 (GRCm39)	missense	possibly damaging	0.92
R6690:Trip11	UTSW	12	101,851,710 (GRCm39)	missense	possibly damaging	0.92
R6914:Trip11	UTSW	12	101,812,879 (GRCm39)	missense	probably benign	0.00
R6938:Trip11	UTSW	12	101,803,886 (GRCm39)	missense	probably damaging	0.98
R7015:Trip11	UTSW	12	101,859,942 (GRCm39)	missense	probably damaging	1.00
R7023:Trip11	UTSW	12	101,852,126 (GRCm39)	missense	probably benign	0.13
R7133:Trip11	UTSW	12	101,850,329 (GRCm39)	missense	probably damaging	0.97
R7271:Trip11	UTSW	12	101,850,611 (GRCm39)	missense	probably damaging	1.00
R7424:Trip11	UTSW	12	101,851,457 (GRCm39)	missense	probably damaging	1.00
R7431:Trip11	UTSW	12	101,850,278 (GRCm39)	missense	possibly damaging	0.84
R7472:Trip11	UTSW	12	101,851,639 (GRCm39)	missense	probably benign	0.00
R7491:Trip11	UTSW	12	101,851,694 (GRCm39)	missense	probably damaging	1.00
R7752:Trip11	UTSW	12	101,853,233 (GRCm39)	missense	probably benign	0.01
R7763:Trip11	UTSW	12	101,811,114 (GRCm39)	missense	probably benign	0.03
R7779:Trip11	UTSW	12	101,849,796 (GRCm39)	missense	probably damaging	0.97
R7844:Trip11	UTSW	12	101,844,403 (GRCm39)	missense	probably damaging	1.00
R8055:Trip11	UTSW	12	101,803,924 (GRCm39)	missense	probably damaging	1.00
R8076:Trip11	UTSW	12	101,849,741 (GRCm39)	missense	probably damaging	1.00
R8288:Trip11	UTSW	12	101,860,643 (GRCm39)	missense	possibly damaging	0.73
R8294:Trip11	UTSW	12	101,811,160 (GRCm39)	missense	possibly damaging	0.93
R8318:Trip11	UTSW	12	101,879,063 (GRCm39)	missense	unknown
R8690:Trip11	UTSW	12	101,839,656 (GRCm39)	missense	possibly damaging	0.76
R8879:Trip11	UTSW	12	101,828,857 (GRCm39)	missense	probably benign	0.00
R8964:Trip11	UTSW	12	101,811,315 (GRCm39)	critical splice donor site	probably null
R9005:Trip11	UTSW	12	101,845,131 (GRCm39)	missense	probably benign	0.02
R9013:Trip11	UTSW	12	101,851,377 (GRCm39)	missense	probably damaging	0.99
R9020:Trip11	UTSW	12	101,850,770 (GRCm39)	missense	possibly damaging	0.91
R9041:Trip11	UTSW	12	101,845,127 (GRCm39)	missense	probably benign	0.06
R9234:Trip11	UTSW	12	101,811,990 (GRCm39)	critical splice donor site	probably null
R9447:Trip11	UTSW	12	101,850,148 (GRCm39)	missense	probably damaging	1.00
R9631:Trip11	UTSW	12	101,859,807 (GRCm39)	missense	probably benign
R9641:Trip11	UTSW	12	101,859,957 (GRCm39)	nonsense	probably null
R9691:Trip11	UTSW	12	101,850,123 (GRCm39)	missense	probably benign	0.00
R9751:Trip11	UTSW	12	101,850,765 (GRCm39)	missense	possibly damaging	0.54
X0020:Trip11	UTSW	12	101,852,172 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGTTCAGCACCTAGACAACTG -3'
(R):5'- GCATGGTTCCAGTACAAAGGAG -3'

Sequencing Primer
(F):5'- AACTGACTGAAGTGTGCCC -3'
(R):5'- CATGGTTCCAGTACAAAGGAGTTAGG -3'

Posted On

2015-06-24