Incidental Mutation 'R4307:1500009L16Rik'
List |< first << previous [record 11 of 10171] next >> last >|
ID324066
Institutional Source Beutler Lab
Gene Symbol 1500009L16Rik
Ensembl Gene ENSMUSG00000087651
Gene NameRIKEN cDNA 1500009L16 gene
Synonyms
MMRRC Submission 041658-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R4307 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location83722865-83762762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 83737928 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 22 (K22N)
Ref Sequence ENSEMBL: ENSMUSP00000129542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000150459]
Predicted Effect probably damaging
Transcript: ENSMUST00000150459
AA Change: K22N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129542
Gene: ENSMUSG00000087651
AA Change: K22N

DomainStartEndE-ValueType
Pfam:OCC1 1 62 4.3e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218196
Predicted Effect unknown
Transcript: ENSMUST00000218623
AA Change: K6N
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Ccr5 T C 9: 124,125,074 L238P possibly damaging Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Efemp2 T A 19: 5,481,621 Y430N possibly damaging Het
Egf T A 3: 129,719,095 Y473F probably damaging Het
Emilin3 T C 2: 160,908,317 E504G probably damaging Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Fuk G A 8: 110,892,080 Q349* probably null Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Gpbp1 T C 13: 111,448,983 *68W probably null Het
Gpm6a T C 8: 55,047,393 probably null Het
Inpp5a T C 7: 139,574,963 S333P possibly damaging Het
Itgb5 T G 16: 33,948,732 Y481D possibly damaging Het
Kif27 C T 13: 58,344,123 V401I probably benign Het
Lca5l C T 16: 96,159,556 probably benign Het
Mkl1 G A 15: 81,016,347 L648F possibly damaging Het
Plxna4 A G 6: 32,163,509 V1648A probably damaging Het
Polk C T 13: 96,496,666 E290K possibly damaging Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Scn7a A T 2: 66,675,755 S1597T possibly damaging Het
Slc5a11 T A 7: 123,269,870 H560Q probably benign Het
Top3b T C 16: 16,889,617 probably benign Het
Unc13c T C 9: 73,693,367 N1365S probably benign Het
Vmn2r101 T A 17: 19,590,161 V403E probably damaging Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Vmn2r28 A T 7: 5,490,708 F80I probably damaging Het
Other mutations in 1500009L16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0483:1500009L16Rik UTSW 10 83759638 splice site probably benign
R3416:1500009L16Rik UTSW 10 83759632 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCATGCACGCACAGATTCAC -3'
(R):5'- AATCTCTGCACAGGTTGGGG -3'

Sequencing Primer
(F):5'- TGCACGCACAGATTCACACATG -3'
(R):5'- TCTAAGCTAGCATGCCAGGGTAAC -3'
Posted On2015-06-24