Incidental Mutation 'R4308:Myo1b'
ID324079
Institutional Source Beutler Lab
Gene Symbol Myo1b
Ensembl Gene ENSMUSG00000018417
Gene Namemyosin IB
Synonyms
MMRRC Submission 041659-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R4308 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location51749765-51916071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51883109 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 37 (K37E)
Ref Sequence ENSEMBL: ENSMUSP00000018561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018561] [ENSMUST00000046390] [ENSMUST00000114537] [ENSMUST00000114541] [ENSMUST00000144694]
Predicted Effect probably benign
Transcript: ENSMUST00000018561
AA Change: K37E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000018561
Gene: ENSMUSG00000018417
AA Change: K37E

DomainStartEndE-ValueType
MYSc 9 702 N/A SMART
IQ 703 725 2.37e-3 SMART
IQ 726 748 2.43e0 SMART
IQ 749 771 5.24e-5 SMART
IQ 778 800 4.59e0 SMART
IQ 807 829 7.07e-2 SMART
IQ 836 858 3.3e-2 SMART
Pfam:Myosin_TH1 941 1128 3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046390
AA Change: K37E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040447
Gene: ENSMUSG00000018417
AA Change: K37E

DomainStartEndE-ValueType
MYSc 9 702 N/A SMART
IQ 703 725 2.37e-3 SMART
IQ 726 748 2.43e0 SMART
IQ 749 771 5.24e-5 SMART
IQ 778 800 3.68e0 SMART
IQ 807 829 3.3e-2 SMART
Pfam:Myosin_TH1 911 1107 3.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114537
AA Change: K37E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110184
Gene: ENSMUSG00000018417
AA Change: K37E

DomainStartEndE-ValueType
MYSc 9 702 N/A SMART
IQ 703 725 2.37e-3 SMART
IQ 726 748 2.43e0 SMART
IQ 749 771 5.24e-5 SMART
IQ 778 800 1.6e0 SMART
Pfam:Myosin_TH1 882 1078 1.9e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114541
AA Change: K43E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110188
Gene: ENSMUSG00000018417
AA Change: K43E

DomainStartEndE-ValueType
MYSc 15 708 N/A SMART
IQ 709 731 2.37e-3 SMART
IQ 732 754 2.43e0 SMART
IQ 755 777 5.24e-5 SMART
IQ 784 806 1.6e0 SMART
Pfam:Myosin_TH1 888 1084 5.8e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126657
Predicted Effect probably benign
Transcript: ENSMUST00000144694
AA Change: K37E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114603
Gene: ENSMUSG00000018417
AA Change: K37E

DomainStartEndE-ValueType
MYSc 9 299 4.69e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186817
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,440,192 T4425M probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Ascc1 T G 10: 60,013,612 H108Q probably benign Het
Bod1l A T 5: 41,791,813 S2989T possibly damaging Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Cyp39a1 T A 17: 43,730,964 probably null Het
Dars2 A G 1: 161,041,721 S653P probably damaging Het
Fam208b A C 13: 3,569,498 S2244R probably damaging Het
Fancm A T 12: 65,126,531 K1872N probably benign Het
Fktn C T 4: 53,724,617 probably benign Het
Gpr33 A T 12: 52,023,640 C205* probably null Het
Gsdmc2 A G 15: 63,848,705 probably benign Het
Il31 A G 5: 123,480,706 S6P probably damaging Het
Iqca T C 1: 90,144,897 K87R probably damaging Het
Kif15 T G 9: 123,013,982 H47Q probably benign Het
L3mbtl3 C T 10: 26,282,792 A653T unknown Het
Lamb1 T C 12: 31,329,255 L1737P probably damaging Het
Map2k5 C G 9: 63,235,304 R353S probably benign Het
Mical2 C A 7: 112,331,992 L721I probably benign Het
Myo5b A G 18: 74,731,740 D1369G possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Olfr1148 T C 2: 87,833,270 I77T probably damaging Het
Olfr116 C T 17: 37,623,736 V300I possibly damaging Het
Pcdhb1 A T 18: 37,266,661 D555V probably benign Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Rnf144b A G 13: 47,242,942 N252D probably damaging Het
Rnf219 T A 14: 104,479,593 N448I probably damaging Het
Rwdd2b A T 16: 87,436,727 W162R probably damaging Het
Scaf11 A G 15: 96,446,515 M19T probably benign Het
Sft2d2 A G 1: 165,188,264 I45T probably benign Het
Skint5 A T 4: 113,483,967 H1371Q unknown Het
Tas2r124 A G 6: 132,754,991 I88V probably benign Het
Ubr4 T C 4: 139,472,509 V4568A possibly damaging Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Vmn2r18 A T 5: 151,584,803 Y285* probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp983 A G 17: 21,662,208 I351V probably benign Het
Other mutations in Myo1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Myo1b APN 1 51763954 missense possibly damaging 0.94
IGL00943:Myo1b APN 1 51784487 missense probably damaging 0.97
IGL01537:Myo1b APN 1 51776351 missense possibly damaging 0.93
IGL01550:Myo1b APN 1 51784531 missense probably damaging 1.00
IGL01610:Myo1b APN 1 51776246 missense probably damaging 1.00
IGL01667:Myo1b APN 1 51760377 missense probably damaging 1.00
IGL01743:Myo1b APN 1 51782020 missense probably damaging 0.96
IGL01830:Myo1b APN 1 51797465 nonsense probably null
IGL02070:Myo1b APN 1 51794337 missense probably damaging 1.00
IGL02398:Myo1b APN 1 51757891 missense probably damaging 1.00
IGL02582:Myo1b APN 1 51781974 missense possibly damaging 0.88
IGL02685:Myo1b APN 1 51778499 missense probably damaging 1.00
IGL02938:Myo1b APN 1 51801178 splice site probably null
IGL02981:Myo1b APN 1 51778373 missense probably damaging 1.00
R0007:Myo1b UTSW 1 51776254 missense probably damaging 1.00
R0007:Myo1b UTSW 1 51776254 missense probably damaging 1.00
R0035:Myo1b UTSW 1 51778382 missense probably damaging 1.00
R0040:Myo1b UTSW 1 51781989 missense probably damaging 1.00
R0040:Myo1b UTSW 1 51781989 missense probably damaging 1.00
R0491:Myo1b UTSW 1 51755698 missense probably benign 0.05
R0959:Myo1b UTSW 1 51797087 missense probably damaging 1.00
R1171:Myo1b UTSW 1 51778525 missense probably damaging 1.00
R1440:Myo1b UTSW 1 51778558 splice site probably benign
R1539:Myo1b UTSW 1 51799563 missense probably damaging 0.97
R1616:Myo1b UTSW 1 51776315 missense probably damaging 1.00
R1888:Myo1b UTSW 1 51760403 critical splice acceptor site probably null
R1888:Myo1b UTSW 1 51760403 critical splice acceptor site probably null
R2697:Myo1b UTSW 1 51863358 missense probably benign 0.04
R3034:Myo1b UTSW 1 51773247 missense possibly damaging 0.83
R3720:Myo1b UTSW 1 51776346 missense possibly damaging 0.79
R3896:Myo1b UTSW 1 51773261 missense probably damaging 0.97
R4003:Myo1b UTSW 1 51799530 critical splice donor site probably null
R4179:Myo1b UTSW 1 51778526 missense probably damaging 1.00
R4444:Myo1b UTSW 1 51757919 missense probably damaging 0.99
R4679:Myo1b UTSW 1 51757973 missense possibly damaging 0.94
R4914:Myo1b UTSW 1 51824208 splice site probably null
R5343:Myo1b UTSW 1 51778537 missense probably benign 0.00
R5530:Myo1b UTSW 1 51797423 missense probably damaging 1.00
R5636:Myo1b UTSW 1 51797528 missense probably damaging 1.00
R5956:Myo1b UTSW 1 51776232 missense probably damaging 1.00
R5974:Myo1b UTSW 1 51778373 missense probably damaging 1.00
R6334:Myo1b UTSW 1 51768651 missense probably null 0.36
R6346:Myo1b UTSW 1 51784507 missense probably damaging 1.00
R6382:Myo1b UTSW 1 51774307 splice site probably null
R6757:Myo1b UTSW 1 51813048 missense probably damaging 1.00
R6952:Myo1b UTSW 1 51762509 missense probably damaging 0.99
R7101:Myo1b UTSW 1 51758001 missense probably benign 0.19
R7192:Myo1b UTSW 1 51757217 missense probably damaging 0.99
R7347:Myo1b UTSW 1 51751254 missense probably damaging 1.00
R7446:Myo1b UTSW 1 51763906 missense possibly damaging 0.87
R7468:Myo1b UTSW 1 51797480 missense possibly damaging 0.78
X0065:Myo1b UTSW 1 51797395 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAACACCGCCCTTGTGCTAG -3'
(R):5'- AGAACTCACCTGAAAGTTTTGCTC -3'

Sequencing Primer
(F):5'- AGTGTGACCTCAACCCATGTG -3'
(R):5'- CCTGAAAGTTTTGCTCATAGACCTG -3'
Posted On2015-06-24