Incidental Mutation 'R4308:Dars2'
ID324082
Institutional Source Beutler Lab
Gene Symbol Dars2
Ensembl Gene ENSMUSG00000026709
Gene Nameaspartyl-tRNA synthetase 2 (mitochondrial)
Synonyms5830468K18Rik
MMRRC Submission 041659-MU
Accession Numbers

Ncbi RefSeq: NM_172644.3; MGI: 2442510

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4308 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location161040601-161070658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 161041721 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 653 (S653P)
Ref Sequence ENSEMBL: ENSMUSP00000041851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035430]
Predicted Effect probably damaging
Transcript: ENSMUST00000035430
AA Change: S653P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041851
Gene: ENSMUSG00000026709
AA Change: S653P

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 65 148 7e-10 PFAM
Pfam:tRNA-synt_2 165 607 1.2e-90 PFAM
Pfam:GAD 355 451 2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199023
Meta Mutation Damage Score 0.0256 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class-II aminoacyl-tRNA synthetase family. It is a mitochondrial enzyme that specifically aminoacylates aspartyl-tRNA. Mutations in this gene are associated with leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL). [provided by RefSeq, Nov 2009]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,440,192 T4425M probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Ascc1 T G 10: 60,013,612 H108Q probably benign Het
Bod1l A T 5: 41,791,813 S2989T possibly damaging Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Cyp39a1 T A 17: 43,730,964 probably null Het
Fam208b A C 13: 3,569,498 S2244R probably damaging Het
Fancm A T 12: 65,126,531 K1872N probably benign Het
Fktn C T 4: 53,724,617 probably benign Het
Gpr33 A T 12: 52,023,640 C205* probably null Het
Gsdmc2 A G 15: 63,848,705 probably benign Het
Il31 A G 5: 123,480,706 S6P probably damaging Het
Iqca T C 1: 90,144,897 K87R probably damaging Het
Kif15 T G 9: 123,013,982 H47Q probably benign Het
L3mbtl3 C T 10: 26,282,792 A653T unknown Het
Lamb1 T C 12: 31,329,255 L1737P probably damaging Het
Map2k5 C G 9: 63,235,304 R353S probably benign Het
Mical2 C A 7: 112,331,992 L721I probably benign Het
Myo1b T C 1: 51,883,109 K37E probably benign Het
Myo5b A G 18: 74,731,740 D1369G possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Olfr1148 T C 2: 87,833,270 I77T probably damaging Het
Olfr116 C T 17: 37,623,736 V300I possibly damaging Het
Pcdhb1 A T 18: 37,266,661 D555V probably benign Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Rnf144b A G 13: 47,242,942 N252D probably damaging Het
Rnf219 T A 14: 104,479,593 N448I probably damaging Het
Rwdd2b A T 16: 87,436,727 W162R probably damaging Het
Scaf11 A G 15: 96,446,515 M19T probably benign Het
Sft2d2 A G 1: 165,188,264 I45T probably benign Het
Skint5 A T 4: 113,483,967 H1371Q unknown Het
Tas2r124 A G 6: 132,754,991 I88V probably benign Het
Ubr4 T C 4: 139,472,509 V4568A possibly damaging Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Vmn2r18 A T 5: 151,584,803 Y285* probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp983 A G 17: 21,662,208 I351V probably benign Het
Other mutations in Dars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0005:Dars2 UTSW 1 161053939 critical splice donor site probably null
R0230:Dars2 UTSW 1 161062787 missense probably benign 0.02
R0537:Dars2 UTSW 1 161060748 missense possibly damaging 0.46
R0709:Dars2 UTSW 1 161046928 missense probably benign 0.00
R1365:Dars2 UTSW 1 161044994 nonsense probably null
R1502:Dars2 UTSW 1 161046805 nonsense probably null
R1625:Dars2 UTSW 1 161054044 missense possibly damaging 0.88
R1934:Dars2 UTSW 1 161063241 splice site probably null
R2239:Dars2 UTSW 1 161063282 missense possibly damaging 0.83
R3721:Dars2 UTSW 1 161063308 missense probably benign 0.03
R4786:Dars2 UTSW 1 161060760 missense probably damaging 1.00
R4859:Dars2 UTSW 1 161044990 missense probably damaging 0.99
R4903:Dars2 UTSW 1 161051371 missense probably benign 0.06
R5042:Dars2 UTSW 1 161045094 intron probably benign
R5068:Dars2 UTSW 1 161041913 missense probably benign 0.02
R6257:Dars2 UTSW 1 161041828 missense probably damaging 1.00
R7286:Dars2 UTSW 1 161046808 missense possibly damaging 0.85
R7444:Dars2 UTSW 1 161046884 missense possibly damaging 0.94
X0063:Dars2 UTSW 1 161056493 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGCTTGGAAAACAGGAAGACTC -3'
(R):5'- AGCATCAGAGATGTCATAGCC -3'

Sequencing Primer
(F):5'- GGAAAACAGGAAGACTCTAAATACTC -3'
(R):5'- GAGATGTCATAGCCTTCCCTAAATC -3'
Posted On2015-06-24