Incidental Mutation 'R4308:Vmn2r18'
ID324095
Institutional Source Beutler Lab
Gene Symbol Vmn2r18
Ensembl Gene ENSMUSG00000091794
Gene Namevomeronasal 2, receptor 18
SynonymsEG632671
MMRRC Submission 041659-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4308 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location151561661-151586906 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 151584803 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 285 (Y285*)
Ref Sequence ENSEMBL: ENSMUSP00000127506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165928]
Predicted Effect probably null
Transcript: ENSMUST00000165928
AA Change: Y285*
SMART Domains Protein: ENSMUSP00000127506
Gene: ENSMUSG00000091794
AA Change: Y285*

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 403 5.7e-39 PFAM
Pfam:NCD3G 446 499 5.5e-20 PFAM
Pfam:7tm_3 531 767 5e-53 PFAM
Meta Mutation Damage Score 0.6424 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,440,192 T4425M probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Ascc1 T G 10: 60,013,612 H108Q probably benign Het
Bod1l A T 5: 41,791,813 S2989T possibly damaging Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Cyp39a1 T A 17: 43,730,964 probably null Het
Dars2 A G 1: 161,041,721 S653P probably damaging Het
Fam208b A C 13: 3,569,498 S2244R probably damaging Het
Fancm A T 12: 65,126,531 K1872N probably benign Het
Fktn C T 4: 53,724,617 probably benign Het
Gpr33 A T 12: 52,023,640 C205* probably null Het
Gsdmc2 A G 15: 63,848,705 probably benign Het
Il31 A G 5: 123,480,706 S6P probably damaging Het
Iqca T C 1: 90,144,897 K87R probably damaging Het
Kif15 T G 9: 123,013,982 H47Q probably benign Het
L3mbtl3 C T 10: 26,282,792 A653T unknown Het
Lamb1 T C 12: 31,329,255 L1737P probably damaging Het
Map2k5 C G 9: 63,235,304 R353S probably benign Het
Mical2 C A 7: 112,331,992 L721I probably benign Het
Myo1b T C 1: 51,883,109 K37E probably benign Het
Myo5b A G 18: 74,731,740 D1369G possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Olfr1148 T C 2: 87,833,270 I77T probably damaging Het
Olfr116 C T 17: 37,623,736 V300I possibly damaging Het
Pcdhb1 A T 18: 37,266,661 D555V probably benign Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Rnf144b A G 13: 47,242,942 N252D probably damaging Het
Rnf219 T A 14: 104,479,593 N448I probably damaging Het
Rwdd2b A T 16: 87,436,727 W162R probably damaging Het
Scaf11 A G 15: 96,446,515 M19T probably benign Het
Sft2d2 A G 1: 165,188,264 I45T probably benign Het
Skint5 A T 4: 113,483,967 H1371Q unknown Het
Tas2r124 A G 6: 132,754,991 I88V probably benign Het
Ubr4 T C 4: 139,472,509 V4568A possibly damaging Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp983 A G 17: 21,662,208 I351V probably benign Het
Other mutations in Vmn2r18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Vmn2r18 APN 5 151572831 missense probably damaging 0.99
IGL01564:Vmn2r18 APN 5 151585168 missense possibly damaging 0.69
IGL01602:Vmn2r18 APN 5 151586641 missense possibly damaging 0.64
IGL01605:Vmn2r18 APN 5 151586641 missense possibly damaging 0.64
IGL01619:Vmn2r18 APN 5 151586764 missense probably benign 0.25
IGL02177:Vmn2r18 APN 5 151586809 missense possibly damaging 0.76
IGL02682:Vmn2r18 APN 5 151584637 missense probably damaging 0.99
IGL02751:Vmn2r18 APN 5 151584607 missense probably benign 0.09
IGL02977:Vmn2r18 APN 5 151586684 missense probably damaging 1.00
R0089:Vmn2r18 UTSW 5 151584804 missense probably benign 0.00
R0282:Vmn2r18 UTSW 5 151585203 missense probably benign 0.02
R0529:Vmn2r18 UTSW 5 151562523 missense probably damaging 0.99
R0812:Vmn2r18 UTSW 5 151572930 splice site probably benign
R1467:Vmn2r18 UTSW 5 151586836 missense possibly damaging 0.48
R1467:Vmn2r18 UTSW 5 151586836 missense possibly damaging 0.48
R1506:Vmn2r18 UTSW 5 151575634 intron probably null
R1562:Vmn2r18 UTSW 5 151586836 missense probably benign 0.12
R1637:Vmn2r18 UTSW 5 151584757 missense probably damaging 1.00
R1651:Vmn2r18 UTSW 5 151561999 missense probably damaging 1.00
R1883:Vmn2r18 UTSW 5 151575725 missense probably benign 0.37
R1884:Vmn2r18 UTSW 5 151575725 missense probably benign 0.37
R1914:Vmn2r18 UTSW 5 151575821 missense probably benign 0.02
R2051:Vmn2r18 UTSW 5 151562551 missense possibly damaging 0.90
R2056:Vmn2r18 UTSW 5 151584695 missense probably damaging 0.98
R2252:Vmn2r18 UTSW 5 151584976 missense possibly damaging 0.59
R2265:Vmn2r18 UTSW 5 151586662 missense probably damaging 1.00
R2266:Vmn2r18 UTSW 5 151586662 missense probably damaging 1.00
R2267:Vmn2r18 UTSW 5 151586662 missense probably damaging 1.00
R2843:Vmn2r18 UTSW 5 151562284 missense probably damaging 1.00
R3023:Vmn2r18 UTSW 5 151561683 missense probably benign 0.13
R3694:Vmn2r18 UTSW 5 151584568 missense probably benign 0.00
R3763:Vmn2r18 UTSW 5 151585179 missense probably damaging 1.00
R3816:Vmn2r18 UTSW 5 151561683 missense probably benign 0.13
R4007:Vmn2r18 UTSW 5 151585246 missense probably damaging 0.99
R4152:Vmn2r18 UTSW 5 151562265 missense probably damaging 1.00
R4362:Vmn2r18 UTSW 5 151572903 missense probably damaging 1.00
R4618:Vmn2r18 UTSW 5 151584959 missense possibly damaging 0.64
R4716:Vmn2r18 UTSW 5 151562137 missense possibly damaging 0.87
R4817:Vmn2r18 UTSW 5 151585432 intron probably null
R5111:Vmn2r18 UTSW 5 151562448 missense possibly damaging 0.85
R5692:Vmn2r18 UTSW 5 151562259 missense possibly damaging 0.65
R6115:Vmn2r18 UTSW 5 151584997 missense possibly damaging 0.81
R6244:Vmn2r18 UTSW 5 151584651 missense probably damaging 1.00
R6595:Vmn2r18 UTSW 5 151562424 missense probably damaging 1.00
R6997:Vmn2r18 UTSW 5 151561873 missense possibly damaging 0.95
R7227:Vmn2r18 UTSW 5 151572799 missense probably damaging 1.00
R7349:Vmn2r18 UTSW 5 151562217 nonsense probably null
R7506:Vmn2r18 UTSW 5 151585020 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- ATGGGCCACTGCATACACTG -3'
(R):5'- CTCTATGGTGATATAGATGACTTGCTG -3'

Sequencing Primer
(F):5'- GGGCCACTGCATACACTGTATTC -3'
(R):5'- TGGAAAATAAACTTCTGTCAAGCAG -3'
Posted On2015-06-24