Incidental Mutation 'R4308:Fancm'
ID324106
Institutional Source Beutler Lab
Gene Symbol Fancm
Ensembl Gene ENSMUSG00000055884
Gene NameFanconi anemia, complementation group M
SynonymsD12Ertd364e, C730036B14Rik
MMRRC Submission 041659-MU
Accession Numbers

Ncbi RefSeq: NM_178912.3; MGI:2442306

Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R4308 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location65075603-65132058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65126531 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1872 (K1872N)
Ref Sequence ENSEMBL: ENSMUSP00000054797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058889] [ENSMUST00000222540]
Predicted Effect probably benign
Transcript: ENSMUST00000058889
AA Change: K1872N

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000054797
Gene: ENSMUSG00000055884
AA Change: K1872N

DomainStartEndE-ValueType
DEXDc 75 275 5.6e-25 SMART
Blast:DEXDc 295 323 9e-6 BLAST
low complexity region 339 348 N/A INTRINSIC
HELICc 475 566 5.64e-21 SMART
Pfam:FANCM-MHF_bd 657 770 8.5e-50 PFAM
low complexity region 850 866 N/A INTRINSIC
low complexity region 974 987 N/A INTRINSIC
low complexity region 1105 1120 N/A INTRINSIC
low complexity region 1165 1178 N/A INTRINSIC
PDB:4DAY|C 1207 1238 1e-6 PDB
low complexity region 1489 1506 N/A INTRINSIC
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 1669 1682 N/A INTRINSIC
ERCC4 1780 1863 2.07e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222086
Predicted Effect probably benign
Transcript: ENSMUST00000222540
Meta Mutation Damage Score 0.1108 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
MGI Phenotype Strain: 4355560
Lethality: D500-D600
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group M. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female transmission, hypogonadism, premature death, and increased incidence of tumors. [provided by MGI curators]
Allele List at MGI

All alleles(39) : Targeted(4) Gene trapped(35)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,440,192 T4425M probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Ascc1 T G 10: 60,013,612 H108Q probably benign Het
Bod1l A T 5: 41,791,813 S2989T possibly damaging Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Cyp39a1 T A 17: 43,730,964 probably null Het
Dars2 A G 1: 161,041,721 S653P probably damaging Het
Fam208b A C 13: 3,569,498 S2244R probably damaging Het
Fktn C T 4: 53,724,617 probably benign Het
Gpr33 A T 12: 52,023,640 C205* probably null Het
Gsdmc2 A G 15: 63,848,705 probably benign Het
Il31 A G 5: 123,480,706 S6P probably damaging Het
Iqca T C 1: 90,144,897 K87R probably damaging Het
Kif15 T G 9: 123,013,982 H47Q probably benign Het
L3mbtl3 C T 10: 26,282,792 A653T unknown Het
Lamb1 T C 12: 31,329,255 L1737P probably damaging Het
Map2k5 C G 9: 63,235,304 R353S probably benign Het
Mical2 C A 7: 112,331,992 L721I probably benign Het
Myo1b T C 1: 51,883,109 K37E probably benign Het
Myo5b A G 18: 74,731,740 D1369G possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Olfr1148 T C 2: 87,833,270 I77T probably damaging Het
Olfr116 C T 17: 37,623,736 V300I possibly damaging Het
Pcdhb1 A T 18: 37,266,661 D555V probably benign Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Rnf144b A G 13: 47,242,942 N252D probably damaging Het
Rnf219 T A 14: 104,479,593 N448I probably damaging Het
Rwdd2b A T 16: 87,436,727 W162R probably damaging Het
Scaf11 A G 15: 96,446,515 M19T probably benign Het
Sft2d2 A G 1: 165,188,264 I45T probably benign Het
Skint5 A T 4: 113,483,967 H1371Q unknown Het
Tas2r124 A G 6: 132,754,991 I88V probably benign Het
Ubr4 T C 4: 139,472,509 V4568A possibly damaging Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Vmn2r18 A T 5: 151,584,803 Y285* probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp983 A G 17: 21,662,208 I351V probably benign Het
Other mutations in Fancm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Fancm APN 12 65075736 missense possibly damaging 0.50
IGL00489:Fancm APN 12 65106193 missense probably benign 0.01
IGL00529:Fancm APN 12 65130417 utr 3 prime probably benign
IGL00898:Fancm APN 12 65106000 missense probably benign 0.01
IGL01805:Fancm APN 12 65113861 critical splice donor site probably null
IGL01986:Fancm APN 12 65126655 nonsense probably null
IGL02026:Fancm APN 12 65105734 missense probably benign 0.03
IGL02069:Fancm APN 12 65075911 missense probably benign 0.05
IGL02103:Fancm APN 12 65095784 missense probably benign 0.38
IGL02133:Fancm APN 12 65106475 missense probably benign 0.04
IGL02400:Fancm APN 12 65113815 missense probably damaging 1.00
IGL02478:Fancm APN 12 65077090 missense probably damaging 1.00
IGL02479:Fancm APN 12 65106485 missense probably damaging 0.98
IGL02563:Fancm APN 12 65092462 missense probably damaging 1.00
IGL02606:Fancm APN 12 65076139 missense possibly damaging 0.90
IGL02731:Fancm APN 12 65088305 missense probably benign 0.00
IGL02809:Fancm APN 12 65121667 missense possibly damaging 0.54
IGL02953:Fancm APN 12 65121966 missense probably benign 0.27
IGL03066:Fancm APN 12 65125114 nonsense probably null
IGL03073:Fancm APN 12 65101632 missense probably damaging 1.00
PIT4131001:Fancm UTSW 12 65105422 missense probably benign 0.03
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0125:Fancm UTSW 12 65121956 missense possibly damaging 0.68
R0201:Fancm UTSW 12 65101632 missense probably damaging 1.00
R0360:Fancm UTSW 12 65075950 missense probably damaging 1.00
R0491:Fancm UTSW 12 65106061 missense probably benign 0.32
R0557:Fancm UTSW 12 65118442 critical splice donor site probably null
R0617:Fancm UTSW 12 65097317 nonsense probably null
R1201:Fancm UTSW 12 65106768 missense possibly damaging 0.66
R1353:Fancm UTSW 12 65088170 missense probably damaging 1.00
R1456:Fancm UTSW 12 65118351 missense possibly damaging 0.48
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1521:Fancm UTSW 12 65121704 missense probably benign 0.25
R1530:Fancm UTSW 12 65092490 critical splice donor site probably null
R1559:Fancm UTSW 12 65093689 missense probably benign 0.00
R1632:Fancm UTSW 12 65130331 missense probably damaging 1.00
R1681:Fancm UTSW 12 65105656 missense probably benign 0.03
R1919:Fancm UTSW 12 65105520 missense possibly damaging 0.48
R1969:Fancm UTSW 12 65101692 missense probably benign 0.09
R1971:Fancm UTSW 12 65101692 missense probably benign 0.09
R2117:Fancm UTSW 12 65077174 missense probably damaging 1.00
R2510:Fancm UTSW 12 65113770 splice site probably benign
R2909:Fancm UTSW 12 65124856 missense probably damaging 1.00
R3155:Fancm UTSW 12 65116421 missense probably benign 0.32
R3405:Fancm UTSW 12 65075772 missense probably benign 0.00
R4133:Fancm UTSW 12 65120530 missense probably benign 0.44
R4588:Fancm UTSW 12 65118441 critical splice donor site probably null
R4602:Fancm UTSW 12 65124944 missense probably benign 0.12
R4653:Fancm UTSW 12 65083054 missense probably damaging 0.99
R4702:Fancm UTSW 12 65122052 missense possibly damaging 0.95
R4719:Fancm UTSW 12 65121706 missense possibly damaging 0.64
R4885:Fancm UTSW 12 65102643 nonsense probably null
R4896:Fancm UTSW 12 65075831 missense probably damaging 1.00
R4908:Fancm UTSW 12 65094871 missense probably benign 0.28
R4921:Fancm UTSW 12 65077141 missense probably benign 0.19
R4922:Fancm UTSW 12 65106892 critical splice donor site probably null
R4948:Fancm UTSW 12 65090974 missense probably damaging 1.00
R5103:Fancm UTSW 12 65105858 missense probably damaging 0.99
R5577:Fancm UTSW 12 65130411 utr 3 prime probably benign
R5631:Fancm UTSW 12 65113843 missense probably damaging 0.97
R5741:Fancm UTSW 12 65101615 missense probably benign 0.01
R6137:Fancm UTSW 12 65130382 missense probably damaging 1.00
R6167:Fancm UTSW 12 65094895 missense probably benign 0.42
R6242:Fancm UTSW 12 65116442 missense probably benign 0.01
R6242:Fancm UTSW 12 65116449 missense probably benign 0.00
R6281:Fancm UTSW 12 65088270 missense probably damaging 1.00
R6325:Fancm UTSW 12 65125052 missense probably damaging 1.00
R6434:Fancm UTSW 12 65077168 missense probably damaging 1.00
R6493:Fancm UTSW 12 65097488 missense probably benign 0.04
R6542:Fancm UTSW 12 65097429 missense probably damaging 1.00
R6645:Fancm UTSW 12 65106100 missense probably damaging 0.99
R6878:Fancm UTSW 12 65116423 nonsense probably null
R7171:Fancm UTSW 12 65101620 missense probably damaging 0.99
R7172:Fancm UTSW 12 65106054 missense possibly damaging 0.95
R7498:Fancm UTSW 12 65099391 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCAGTGATGAGATGGTAGAATTTC -3'
(R):5'- GGAAGTGCTTCAAGTTTACTAGTG -3'

Sequencing Primer
(F):5'- GGCATCGGATCCCATTACAGATG -3'
(R):5'- GTTTAGCACTGCTGGGATATGAATAC -3'
Posted On2015-06-24