Incidental Mutation 'R4308:Scaf11'
ID324113
Institutional Source Beutler Lab
Gene Symbol Scaf11
Ensembl Gene ENSMUSG00000033228
Gene NameSR-related CTD-associated factor 11
SynonymsSrsf2ip, Sfrs2ip, SIP1, CASP11, 1110061H03Rik, SRRP129, 2610510E10Rik
MMRRC Submission 041659-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4308 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location96411699-96460843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96446515 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 19 (M19T)
Ref Sequence ENSEMBL: ENSMUSP00000154321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047835] [ENSMUST00000227069] [ENSMUST00000228535]
Predicted Effect probably benign
Transcript: ENSMUST00000047835
AA Change: M19T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044898
Gene: ENSMUSG00000033228
AA Change: M19T

DomainStartEndE-ValueType
RING 41 81 1.57e-2 SMART
low complexity region 308 327 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 919 978 N/A INTRINSIC
low complexity region 1089 1108 N/A INTRINSIC
low complexity region 1177 1188 N/A INTRINSIC
low complexity region 1283 1311 N/A INTRINSIC
low complexity region 1346 1359 N/A INTRINSIC
Blast:IG_like 1374 1415 5e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000227069
AA Change: M19T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227133
Predicted Effect unknown
Transcript: ENSMUST00000228260
AA Change: M19T
Predicted Effect probably benign
Transcript: ENSMUST00000228535
Meta Mutation Damage Score 0.012 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,440,192 T4425M probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Ascc1 T G 10: 60,013,612 H108Q probably benign Het
Bod1l A T 5: 41,791,813 S2989T possibly damaging Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Cyp39a1 T A 17: 43,730,964 probably null Het
Dars2 A G 1: 161,041,721 S653P probably damaging Het
Fam208b A C 13: 3,569,498 S2244R probably damaging Het
Fancm A T 12: 65,126,531 K1872N probably benign Het
Fktn C T 4: 53,724,617 probably benign Het
Gpr33 A T 12: 52,023,640 C205* probably null Het
Gsdmc2 A G 15: 63,848,705 probably benign Het
Il31 A G 5: 123,480,706 S6P probably damaging Het
Iqca T C 1: 90,144,897 K87R probably damaging Het
Kif15 T G 9: 123,013,982 H47Q probably benign Het
L3mbtl3 C T 10: 26,282,792 A653T unknown Het
Lamb1 T C 12: 31,329,255 L1737P probably damaging Het
Map2k5 C G 9: 63,235,304 R353S probably benign Het
Mical2 C A 7: 112,331,992 L721I probably benign Het
Myo1b T C 1: 51,883,109 K37E probably benign Het
Myo5b A G 18: 74,731,740 D1369G possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Olfr1148 T C 2: 87,833,270 I77T probably damaging Het
Olfr116 C T 17: 37,623,736 V300I possibly damaging Het
Pcdhb1 A T 18: 37,266,661 D555V probably benign Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Rnf144b A G 13: 47,242,942 N252D probably damaging Het
Rnf219 T A 14: 104,479,593 N448I probably damaging Het
Rwdd2b A T 16: 87,436,727 W162R probably damaging Het
Sft2d2 A G 1: 165,188,264 I45T probably benign Het
Skint5 A T 4: 113,483,967 H1371Q unknown Het
Tas2r124 A G 6: 132,754,991 I88V probably benign Het
Ubr4 T C 4: 139,472,509 V4568A possibly damaging Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Vmn2r18 A T 5: 151,584,803 Y285* probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp983 A G 17: 21,662,208 I351V probably benign Het
Other mutations in Scaf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Scaf11 APN 15 96418580 missense possibly damaging 0.94
IGL01386:Scaf11 APN 15 96420480 missense probably damaging 1.00
IGL01449:Scaf11 APN 15 96419126 missense probably benign 0.04
IGL01547:Scaf11 APN 15 96418429 missense probably benign 0.14
IGL01697:Scaf11 APN 15 96423623 splice site probably benign
IGL01780:Scaf11 APN 15 96420844 missense possibly damaging 0.94
IGL02311:Scaf11 APN 15 96418756 missense probably benign 0.01
IGL02740:Scaf11 APN 15 96419002 missense probably benign 0.01
IGL02805:Scaf11 APN 15 96420182 missense possibly damaging 0.69
IGL03383:Scaf11 APN 15 96420183 unclassified probably null
R0173:Scaf11 UTSW 15 96420194 missense probably benign 0.00
R0379:Scaf11 UTSW 15 96431816 missense probably damaging 1.00
R0508:Scaf11 UTSW 15 96420487 missense probably damaging 1.00
R0648:Scaf11 UTSW 15 96418458 missense possibly damaging 0.72
R0653:Scaf11 UTSW 15 96418641 nonsense probably null
R0727:Scaf11 UTSW 15 96419443 missense probably damaging 1.00
R0829:Scaf11 UTSW 15 96418689 missense probably damaging 1.00
R0839:Scaf11 UTSW 15 96423553 missense probably damaging 1.00
R0843:Scaf11 UTSW 15 96431825 missense probably damaging 1.00
R0882:Scaf11 UTSW 15 96418295 missense possibly damaging 0.75
R1994:Scaf11 UTSW 15 96418840 nonsense probably null
R2092:Scaf11 UTSW 15 96415827 missense probably damaging 0.98
R2125:Scaf11 UTSW 15 96419315 missense possibly damaging 0.69
R2200:Scaf11 UTSW 15 96420523 missense probably damaging 1.00
R3409:Scaf11 UTSW 15 96414864 missense probably damaging 1.00
R3751:Scaf11 UTSW 15 96418536 missense probably damaging 0.99
R4424:Scaf11 UTSW 15 96418428 missense possibly damaging 0.78
R4519:Scaf11 UTSW 15 96424838 missense probably damaging 1.00
R4646:Scaf11 UTSW 15 96420100 unclassified probably null
R4647:Scaf11 UTSW 15 96420100 unclassified probably null
R4724:Scaf11 UTSW 15 96414848 missense probably benign 0.40
R4748:Scaf11 UTSW 15 96420421 nonsense probably null
R4926:Scaf11 UTSW 15 96418242 missense possibly damaging 0.87
R4978:Scaf11 UTSW 15 96415917 missense probably damaging 1.00
R5105:Scaf11 UTSW 15 96420432 missense probably damaging 1.00
R5120:Scaf11 UTSW 15 96419542 missense probably benign 0.26
R5277:Scaf11 UTSW 15 96419226 missense probably damaging 1.00
R5377:Scaf11 UTSW 15 96417120 missense possibly damaging 0.55
R5394:Scaf11 UTSW 15 96419458 missense probably benign 0.28
R5481:Scaf11 UTSW 15 96420617 missense probably damaging 1.00
R5831:Scaf11 UTSW 15 96417081 missense probably benign 0.14
R5941:Scaf11 UTSW 15 96420308 missense probably damaging 0.99
R6123:Scaf11 UTSW 15 96420454 missense probably benign 0.29
R6166:Scaf11 UTSW 15 96424662 missense probably damaging 1.00
R6504:Scaf11 UTSW 15 96419460 unclassified probably null
R6863:Scaf11 UTSW 15 96419419 missense probably damaging 1.00
R7135:Scaf11 UTSW 15 96420328 missense possibly damaging 0.82
R7193:Scaf11 UTSW 15 96419161 missense probably damaging 1.00
R7384:Scaf11 UTSW 15 96420387 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTGCATACCTACATAGGAACACA -3'
(R):5'- ACTGATGGGTTTGGCTCATTCT -3'

Sequencing Primer
(F):5'- GCATACCTACATAGGAACACACACAC -3'
(R):5'- ATGGGTTTGGCTCATTCTTTATAAAG -3'
Posted On2015-06-24