Incidental Mutation 'R4343:Slc38a3'
ID324232
Institutional Source Beutler Lab
Gene Symbol Slc38a3
Ensembl Gene ENSMUSG00000010064
Gene Namesolute carrier family 38, member 3
SynonymsSnat3, 0610012J02Rik, D9Ucla2
MMRRC Submission 041665-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.605) question?
Stock #R4343 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location107650634-107669530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107656472 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 224 (V224A)
Ref Sequence ENSEMBL: ENSMUSP00000142087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010208] [ENSMUST00000167868] [ENSMUST00000177567] [ENSMUST00000192323] [ENSMUST00000192990] [ENSMUST00000193932] [ENSMUST00000195843]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010208
AA Change: V224A

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000010208
Gene: ENSMUSG00000010064
AA Change: V224A

DomainStartEndE-ValueType
Pfam:Aa_trans 63 492 1.8e-109 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167868
AA Change: V224A

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130414
Gene: ENSMUSG00000010064
AA Change: V224A

DomainStartEndE-ValueType
Pfam:Aa_trans 63 492 1.8e-109 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177567
AA Change: V224A

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137561
Gene: ENSMUSG00000010064
AA Change: V224A

DomainStartEndE-ValueType
Pfam:Aa_trans 63 492 5.5e-110 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191923
Predicted Effect probably benign
Transcript: ENSMUST00000192211
Predicted Effect probably benign
Transcript: ENSMUST00000192323
SMART Domains Protein: ENSMUSP00000141850
Gene: ENSMUSG00000010064

DomainStartEndE-ValueType
Pfam:Aa_trans 63 181 2.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192990
SMART Domains Protein: ENSMUSP00000141528
Gene: ENSMUSG00000010064

DomainStartEndE-ValueType
Pfam:Aa_trans 63 154 1.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193495
Predicted Effect possibly damaging
Transcript: ENSMUST00000193932
AA Change: V224A

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142087
Gene: ENSMUSG00000010064
AA Change: V224A

DomainStartEndE-ValueType
Pfam:Aa_trans 63 492 1.8e-109 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195033
Predicted Effect unknown
Transcript: ENSMUST00000195739
AA Change: V30A
Predicted Effect probably benign
Transcript: ENSMUST00000195843
SMART Domains Protein: ENSMUSP00000141552
Gene: ENSMUSG00000010064

DomainStartEndE-ValueType
Pfam:Aa_trans 63 99 6.4e-9 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU allele exhibit complete postnatal lethality between P18 and P20, altered amino acid levels in the serum, liver and brain, and decreased ammonia excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd38 A C 5: 43,869,089 I72L probably benign Het
Diras1 T A 10: 81,022,184 K78* probably null Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm8674 T A 13: 49,899,706 noncoding transcript Het
Gnal T C 18: 67,135,588 S182P probably benign Het
Grik1 T C 16: 87,896,252 T932A probably benign Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Lepr G A 4: 101,765,152 probably null Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mki67 A G 7: 135,695,118 V2729A probably benign Het
Mmp20 GA GAA 9: 7,628,345 probably null Het
Myo7b A G 18: 31,983,627 F976L probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Npc1l1 G A 11: 6,217,773 T1006I probably benign Het
Olfr1009 T A 2: 85,722,248 V281E probably damaging Het
Plekha5 A G 6: 140,556,054 E656G probably damaging Het
Pqlc1 A G 18: 80,283,789 probably benign Het
Prep C A 10: 45,120,770 S381R probably damaging Het
Rab31 C T 17: 65,654,419 R192H probably benign Het
Rbm5 T C 9: 107,752,196 D319G probably damaging Het
Rexo2 T C 9: 48,468,848 E228G possibly damaging Het
Rrn3 A G 16: 13,784,122 D80G probably benign Het
Sycp2 T C 2: 178,380,947 T464A probably damaging Het
Tpcn1 A T 5: 120,560,220 L79H probably damaging Het
Trim30a T C 7: 104,435,592 Q137R probably benign Het
Tyrp1 A G 4: 80,849,841 D92G possibly damaging Het
Ugt1a6a T C 1: 88,138,526 L18P probably damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Zmym2 T A 14: 56,921,562 M598K probably damaging Het
Other mutations in Slc38a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Slc38a3 APN 9 107658677 missense probably damaging 1.00
PIT4354001:Slc38a3 UTSW 9 107657649 missense probably benign 0.01
R0522:Slc38a3 UTSW 9 107655213 unclassified probably null
R0865:Slc38a3 UTSW 9 107655648 missense probably damaging 1.00
R0919:Slc38a3 UTSW 9 107655959 missense probably damaging 1.00
R1265:Slc38a3 UTSW 9 107651986 missense probably damaging 1.00
R1864:Slc38a3 UTSW 9 107655953 missense probably damaging 1.00
R2919:Slc38a3 UTSW 9 107657687 missense probably damaging 1.00
R4209:Slc38a3 UTSW 9 107655348 missense possibly damaging 0.78
R4534:Slc38a3 UTSW 9 107656206 missense probably benign 0.00
R4535:Slc38a3 UTSW 9 107656206 missense probably benign 0.00
R4860:Slc38a3 UTSW 9 107655064 missense probably damaging 1.00
R4860:Slc38a3 UTSW 9 107655064 missense probably damaging 1.00
R4916:Slc38a3 UTSW 9 107656227 missense probably benign
R5058:Slc38a3 UTSW 9 107659191 missense possibly damaging 0.53
R5219:Slc38a3 UTSW 9 107651912 unclassified probably benign
R5776:Slc38a3 UTSW 9 107658749 nonsense probably null
R6029:Slc38a3 UTSW 9 107652175 missense probably damaging 1.00
R6146:Slc38a3 UTSW 9 107655029 missense probably benign
R6292:Slc38a3 UTSW 9 107655154 missense possibly damaging 0.88
R7250:Slc38a3 UTSW 9 107656666 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGAGTGTCAGAGTCAGGCAG -3'
(R):5'- CCACTGCTTATTCCTGTAGGGTG -3'

Sequencing Primer
(F):5'- TCAGAGTCAGGCAGAGCTGTC -3'
(R):5'- CATGGATGGCAACTACCTTGTGATC -3'
Posted On2015-06-24