Mutagenetix > Incidental Mutation

Incidental Mutation 'R4344:Adgrb3'

324245

Institutional Source

Beutler Lab

Gene Symbol

Adgrb3

Ensembl Gene

ENSMUSG00000033569

Gene Name

adhesion G protein-coupled receptor B3

Synonyms

Bai3, A830096D10Rik

MMRRC Submission

041101-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.409) question?

Stock #

R4344 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25106557-25868788 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 25865829 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 5 (R5S)

Ref Sequence

ENSEMBL: ENSMUSP00000116231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041838] [ENSMUST00000135518] [ENSMUST00000146592] [ENSMUST00000151309]

AlphaFold

Q80ZF8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041838
AA Change: R5S

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000035612
Gene: ENSMUSG00000033569
AA Change: R5S

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
TSP1	294	343	2.1e-12	SMART
TSP1	348	398	7.97e-13	SMART
TSP1	403	453	6.28e-11	SMART
TSP1	458	508	1.48e-7	SMART
HormR	510	576	4.15e-20	SMART
Pfam:DUF3497	586	810	1.7e-52	PFAM
GPS	815	868	1.24e-21	SMART
Pfam:7tm_2	874	1143	2.1e-64	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000135518
AA Change: R5S

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569
AA Change: R5S

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
TSP1	294	343	2.1e-12	SMART
TSP1	348	398	7.97e-13	SMART
TSP1	403	453	6.28e-11	SMART
TSP1	458	508	1.48e-7	SMART
HormR	510	576	4.15e-20	SMART
Pfam:DUF3497	586	810	1.7e-52	PFAM
GPS	815	868	1.24e-21	SMART
Pfam:7tm_2	874	1143	2.1e-64	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000146592

SMART Domains

Protein: ENSMUSP00000116759
Gene: ENSMUSG00000033569

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
TSP1	87	136	2.1e-12	SMART
TSP1	141	191	7.97e-13	SMART
TSP1	196	246	6.28e-11	SMART
TSP1	251	301	1.48e-7	SMART
HormR	303	369	4.15e-20	SMART
Pfam:DUF3497	379	603	2.5e-52	PFAM
GPS	608	661	1.24e-21	SMART
Pfam:7tm_2	667	903	5.4e-66	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000151309
AA Change: R5S

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000116231
Gene: ENSMUSG00000033569
AA Change: R5S

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
TSP1	294	343	2.1e-12	SMART
TSP1	348	398	7.97e-13	SMART
TSP1	403	453	6.28e-11	SMART
TSP1	458	508	1.48e-7	SMART
HormR	510	576	4.15e-20	SMART
Pfam:GAIN	589	794	1.1e-44	PFAM
GPS	815	868	1.24e-21	SMART
Pfam:7tm_2	875	1143	2.7e-63	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189254

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194343

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195754

Meta Mutation Damage Score

0.1860

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (39/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Purkinje cells exhibit impaired motor learning with alterned climbing fiber electrophysiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ccdc168	G	A	1: 44,100,151 (GRCm39)	L316F	possibly damaging	Het
Ccdc187	T	A	2: 26,170,681 (GRCm39)	K599I	probably damaging	Het
Ccn5	G	A	2: 163,670,906 (GRCm39)	V138M	probably damaging	Het
Cd38	A	C	5: 44,026,431 (GRCm39)	I72L	probably benign	Het
Cep19	C	T	16: 31,925,883 (GRCm39)	T97M	probably damaging	Het
Ces2a	T	G	8: 105,463,766 (GRCm39)	D159E	probably damaging	Het
Dcc	G	A	18: 71,507,561 (GRCm39)	A917V	probably damaging	Het
Dennd6b	G	A	15: 89,072,866 (GRCm39)	A196V	probably benign	Het
Dlgap3	T	C	4: 127,108,141 (GRCm39)	S475P	possibly damaging	Het
Doc2a	C	T	7: 126,450,321 (GRCm39)	P156S	probably damaging	Het
Elmo1	T	A	13: 20,445,722 (GRCm39)		probably null	Het
Fbf1	A	G	11: 116,038,568 (GRCm39)	V851A	probably benign	Het
Fhdc1	C	A	3: 84,352,133 (GRCm39)	V1031F	probably benign	Het
Gm5878	G	A	6: 85,102,633 (GRCm39)	R31*	probably null	Het
Klk1b8	C	A	7: 43,595,186 (GRCm39)		probably benign	Het
Lmcd1	T	A	6: 112,264,968 (GRCm39)		probably benign	Het
Lyst	T	A	13: 13,873,051 (GRCm39)	I2750K	probably benign	Het
Muc4	A	G	16: 32,590,666 (GRCm39)	N2958S	possibly damaging	Het
Plod3	G	C	5: 137,017,000 (GRCm39)	A50P	probably benign	Het
Ppp1r16b	G	A	2: 158,591,106 (GRCm39)	V163I	probably damaging	Het
Prkdc	T	A	16: 15,585,886 (GRCm39)	W2475R	probably damaging	Het
Rad54l	C	T	4: 115,954,551 (GRCm39)	C684Y	probably damaging	Het
Ralgds	T	C	2: 28,442,107 (GRCm39)	L96P	probably damaging	Het
Rasef	T	A	4: 73,663,326 (GRCm39)	H167L	probably damaging	Het
Sh3bp2	T	C	5: 34,712,886 (GRCm39)	F165L	possibly damaging	Het
Slc38a9	T	C	13: 112,865,749 (GRCm39)	I482T	probably benign	Het
Tmprss6	T	A	15: 78,343,627 (GRCm39)		probably null	Het
Trpm3	A	T	19: 22,875,061 (GRCm39)	S568C	probably damaging	Het
Ttc39c	T	A	18: 12,861,667 (GRCm39)		probably null	Het
Ttn	A	T	2: 76,641,587 (GRCm39)	L5176Q	possibly damaging	Het
Ugt2b5	A	T	5: 87,287,582 (GRCm39)	V195E	probably damaging	Het
Vmn2r22	C	T	6: 123,614,756 (GRCm39)	G278D	probably damaging	Het
Yme1l1	G	A	2: 23,063,073 (GRCm39)	A215T	probably benign	Het
Zmynd15	C	T	11: 70,351,894 (GRCm39)	R38*	probably null	Het

Other mutations in Adgrb3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Adgrb3	APN	1	25,267,581 (GRCm39)	missense	probably benign	0.09
IGL00507:Adgrb3	APN	1	25,113,796 (GRCm39)	missense	possibly damaging	0.93
IGL00828:Adgrb3	APN	1	25,527,200 (GRCm39)	missense	possibly damaging	0.73
IGL01285:Adgrb3	APN	1	25,132,868 (GRCm39)	missense	probably benign	0.32
IGL01309:Adgrb3	APN	1	25,151,352 (GRCm39)	missense	possibly damaging	0.69
IGL01540:Adgrb3	APN	1	25,151,252 (GRCm39)	splice site	probably null
IGL01608:Adgrb3	APN	1	25,592,855 (GRCm39)	missense	probably damaging	1.00
IGL01638:Adgrb3	APN	1	25,598,832 (GRCm39)	splice site	probably benign
IGL01657:Adgrb3	APN	1	25,865,574 (GRCm39)	missense	probably benign	0.03
IGL01666:Adgrb3	APN	1	25,499,832 (GRCm39)	missense	probably damaging	0.96
IGL01712:Adgrb3	APN	1	25,865,360 (GRCm39)	missense	probably benign
IGL01767:Adgrb3	APN	1	25,598,895 (GRCm39)	missense	probably benign	0.00
IGL01987:Adgrb3	APN	1	25,140,512 (GRCm39)	critical splice donor site	probably null
IGL02201:Adgrb3	APN	1	25,459,631 (GRCm39)	splice site	probably benign
IGL02584:Adgrb3	APN	1	25,544,065 (GRCm39)	missense	probably damaging	0.98
IGL02685:Adgrb3	APN	1	25,123,323 (GRCm39)	critical splice donor site	probably null
IGL02886:Adgrb3	APN	1	25,543,991 (GRCm39)	splice site	probably null
IGL02929:Adgrb3	APN	1	25,592,905 (GRCm39)	missense	probably benign	0.00
IGL03153:Adgrb3	APN	1	25,570,978 (GRCm39)	nonsense	probably null
IGL03165:Adgrb3	APN	1	25,133,475 (GRCm39)	missense	probably benign	0.05
IGL03227:Adgrb3	APN	1	25,586,556 (GRCm39)	missense	probably damaging	1.00
IGL03392:Adgrb3	APN	1	25,543,529 (GRCm39)	missense	probably damaging	0.99
schwach	UTSW	1	25,150,772 (GRCm39)	critical splice donor site	probably null
R0007:Adgrb3	UTSW	1	25,150,772 (GRCm39)	critical splice donor site	probably null
R0048:Adgrb3	UTSW	1	25,140,563 (GRCm39)	missense	probably benign	0.02
R0048:Adgrb3	UTSW	1	25,140,563 (GRCm39)	missense	probably benign	0.02
R0322:Adgrb3	UTSW	1	25,260,829 (GRCm39)	splice site	probably benign
R0442:Adgrb3	UTSW	1	25,435,551 (GRCm39)	missense	probably damaging	0.96
R0563:Adgrb3	UTSW	1	25,586,635 (GRCm39)	missense	probably damaging	0.99
R1168:Adgrb3	UTSW	1	25,865,280 (GRCm39)	missense	probably benign
R1252:Adgrb3	UTSW	1	25,167,909 (GRCm39)	missense	probably damaging	1.00
R1264:Adgrb3	UTSW	1	25,598,931 (GRCm39)	missense	probably damaging	0.97
R1543:Adgrb3	UTSW	1	25,527,169 (GRCm39)	missense	probably benign	0.01
R1577:Adgrb3	UTSW	1	25,133,264 (GRCm39)	missense	possibly damaging	0.51
R1581:Adgrb3	UTSW	1	25,133,153 (GRCm39)	missense	possibly damaging	0.94
R1583:Adgrb3	UTSW	1	25,265,912 (GRCm39)	splice site	probably null
R1653:Adgrb3	UTSW	1	25,140,584 (GRCm39)	missense	probably benign	0.09
R1725:Adgrb3	UTSW	1	25,865,381 (GRCm39)	missense	probably damaging	1.00
R1792:Adgrb3	UTSW	1	25,267,552 (GRCm39)	missense	probably damaging	1.00
R1827:Adgrb3	UTSW	1	25,571,658 (GRCm39)	missense	probably damaging	0.99
R1838:Adgrb3	UTSW	1	25,123,351 (GRCm39)	missense	probably damaging	1.00
R1869:Adgrb3	UTSW	1	25,865,519 (GRCm39)	missense	possibly damaging	0.83
R1971:Adgrb3	UTSW	1	25,586,525 (GRCm39)	missense	probably benign	0.02
R2005:Adgrb3	UTSW	1	25,150,799 (GRCm39)	missense	probably benign	0.25
R2134:Adgrb3	UTSW	1	25,133,038 (GRCm39)	missense	probably damaging	0.99
R2142:Adgrb3	UTSW	1	25,107,290 (GRCm39)	missense	probably damaging	1.00
R2268:Adgrb3	UTSW	1	25,150,898 (GRCm39)	missense	possibly damaging	0.79
R3740:Adgrb3	UTSW	1	25,865,535 (GRCm39)	missense	probably benign	0.00
R3877:Adgrb3	UTSW	1	25,150,906 (GRCm39)	missense	probably damaging	1.00
R4120:Adgrb3	UTSW	1	25,133,388 (GRCm39)	nonsense	probably null
R4363:Adgrb3	UTSW	1	25,151,303 (GRCm39)	missense	probably damaging	1.00
R4438:Adgrb3	UTSW	1	25,870,108 (GRCm39)	unclassified	probably benign
R4465:Adgrb3	UTSW	1	25,133,447 (GRCm39)	missense	probably damaging	1.00
R4480:Adgrb3	UTSW	1	25,150,829 (GRCm39)	missense	probably damaging	1.00
R4554:Adgrb3	UTSW	1	25,123,360 (GRCm39)	missense	probably damaging	1.00
R4557:Adgrb3	UTSW	1	25,123,360 (GRCm39)	missense	probably damaging	1.00
R4622:Adgrb3	UTSW	1	25,865,569 (GRCm39)	missense	probably damaging	0.99
R4713:Adgrb3	UTSW	1	25,586,613 (GRCm39)	missense	probably damaging	1.00
R4772:Adgrb3	UTSW	1	25,570,956 (GRCm39)	missense	probably damaging	1.00
R4890:Adgrb3	UTSW	1	25,260,908 (GRCm39)	missense	probably damaging	1.00
R5045:Adgrb3	UTSW	1	25,113,860 (GRCm39)	missense	probably damaging	1.00
R5061:Adgrb3	UTSW	1	25,107,209 (GRCm39)	utr 3 prime	probably benign
R5097:Adgrb3	UTSW	1	25,865,165 (GRCm39)	missense	probably damaging	1.00
R5227:Adgrb3	UTSW	1	25,133,033 (GRCm39)	missense	possibly damaging	0.55
R5241:Adgrb3	UTSW	1	25,150,871 (GRCm39)	missense	possibly damaging	0.85
R5328:Adgrb3	UTSW	1	25,133,356 (GRCm39)	missense	possibly damaging	0.90
R5372:Adgrb3	UTSW	1	25,167,940 (GRCm39)	missense	probably benign	0.01
R5703:Adgrb3	UTSW	1	25,459,640 (GRCm39)	missense	probably damaging	1.00
R5747:Adgrb3	UTSW	1	25,865,643 (GRCm39)	missense	probably damaging	1.00
R5998:Adgrb3	UTSW	1	25,470,582 (GRCm39)	splice site	probably null
R6006:Adgrb3	UTSW	1	25,865,612 (GRCm39)	missense	possibly damaging	0.85
R6077:Adgrb3	UTSW	1	25,133,081 (GRCm39)	nonsense	probably null
R6183:Adgrb3	UTSW	1	25,133,451 (GRCm39)	missense	probably damaging	0.98
R6190:Adgrb3	UTSW	1	25,459,728 (GRCm39)	missense	probably benign	0.01
R6249:Adgrb3	UTSW	1	25,471,639 (GRCm39)	missense	probably damaging	1.00
R6310:Adgrb3	UTSW	1	25,150,799 (GRCm39)	missense	probably benign	0.13
R6450:Adgrb3	UTSW	1	25,459,683 (GRCm39)	missense	probably benign
R6678:Adgrb3	UTSW	1	25,499,891 (GRCm39)	missense	possibly damaging	0.84
R6679:Adgrb3	UTSW	1	25,170,377 (GRCm39)	missense	probably benign	0.01
R6685:Adgrb3	UTSW	1	25,150,817 (GRCm39)	nonsense	probably null
R6730:Adgrb3	UTSW	1	25,133,375 (GRCm39)	missense	probably damaging	1.00
R6805:Adgrb3	UTSW	1	25,865,253 (GRCm39)	missense	possibly damaging	0.83
R6847:Adgrb3	UTSW	1	25,133,003 (GRCm39)	missense	probably benign	0.03
R6929:Adgrb3	UTSW	1	25,150,852 (GRCm39)	nonsense	probably null
R6953:Adgrb3	UTSW	1	25,865,592 (GRCm39)	missense	probably damaging	1.00
R7062:Adgrb3	UTSW	1	25,865,166 (GRCm39)	missense	possibly damaging	0.90
R7244:Adgrb3	UTSW	1	25,170,350 (GRCm39)	missense	probably damaging	1.00
R7292:Adgrb3	UTSW	1	25,570,957 (GRCm39)	missense	probably damaging	1.00
R7325:Adgrb3	UTSW	1	25,571,711 (GRCm39)	missense	probably benign	0.01
R7378:Adgrb3	UTSW	1	25,571,000 (GRCm39)	nonsense	probably null
R7489:Adgrb3	UTSW	1	25,586,586 (GRCm39)	missense	probably damaging	1.00
R7615:Adgrb3	UTSW	1	25,137,978 (GRCm39)	missense	probably damaging	1.00
R7623:Adgrb3	UTSW	1	25,586,629 (GRCm39)	missense	probably damaging	1.00
R7787:Adgrb3	UTSW	1	25,471,625 (GRCm39)	missense	probably damaging	1.00
R7837:Adgrb3	UTSW	1	25,167,915 (GRCm39)	missense	probably damaging	1.00
R8064:Adgrb3	UTSW	1	25,459,637 (GRCm39)	critical splice donor site	probably null
R8152:Adgrb3	UTSW	1	25,260,838 (GRCm39)	splice site	probably null
R8161:Adgrb3	UTSW	1	25,133,003 (GRCm39)	missense	probably benign	0.03
R8225:Adgrb3	UTSW	1	25,865,597 (GRCm39)	missense	probably benign	0.00
R8417:Adgrb3	UTSW	1	25,527,134 (GRCm39)	missense	probably benign	0.21
R8694:Adgrb3	UTSW	1	25,865,472 (GRCm39)	missense	probably damaging	0.98
R8742:Adgrb3	UTSW	1	25,265,835 (GRCm39)	missense	probably benign	0.01
R8886:Adgrb3	UTSW	1	25,150,928 (GRCm39)	missense	probably damaging	1.00
R8941:Adgrb3	UTSW	1	25,133,235 (GRCm39)	missense	probably damaging	1.00
R8958:Adgrb3	UTSW	1	25,865,190 (GRCm39)	missense	possibly damaging	0.68
R8979:Adgrb3	UTSW	1	25,527,115 (GRCm39)	missense	probably benign	0.03
R9064:Adgrb3	UTSW	1	25,570,965 (GRCm39)	missense	possibly damaging	0.86
R9252:Adgrb3	UTSW	1	25,865,496 (GRCm39)	missense	probably benign	0.03
R9401:Adgrb3	UTSW	1	25,592,783 (GRCm39)	missense	probably damaging	1.00
R9739:Adgrb3	UTSW	1	25,592,849 (GRCm39)	missense	probably damaging	1.00
Z1088:Adgrb3	UTSW	1	25,170,352 (GRCm39)	missense	probably damaging	1.00
Z1176:Adgrb3	UTSW	1	25,132,995 (GRCm39)	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- TTTCCAGTGTCCAGGTGCAG -3'
(R):5'- ATCACTACCAACCACGTGAGGG -3'

Sequencing Primer
(F):5'- CAGTGTCCAGGTGCAGTTTGTAAAG -3'
(R):5'- CAGCAACTGATAATTTCCTGGCG -3'

Posted On

2015-06-24