Incidental Mutation 'R4344:Rad54l'
ID324255
Institutional Source Beutler Lab
Gene Symbol Rad54l
Ensembl Gene ENSMUSG00000028702
Gene NameRAD54 like (S. cerevisiae)
SynonymsRAD54
MMRRC Submission 041101-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4344 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116094264-116123690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 116097354 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 684 (C684Y)
Ref Sequence ENSEMBL: ENSMUSP00000099766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030471] [ENSMUST00000102704] [ENSMUST00000102705]
Predicted Effect probably benign
Transcript: ENSMUST00000030471
SMART Domains Protein: ENSMUSP00000030471
Gene: ENSMUSG00000028703

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 352 382 N/A INTRINSIC
low complexity region 417 429 N/A INTRINSIC
SCOP:d1yrga_ 449 742 4e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102704
AA Change: C684Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099765
Gene: ENSMUSG00000028702
AA Change: C684Y

DomainStartEndE-ValueType
DEXDc 149 357 1.66e-41 SMART
Blast:DEXDc 391 427 5e-13 BLAST
low complexity region 441 456 N/A INTRINSIC
HELICc 527 611 1.39e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102705
AA Change: C684Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099766
Gene: ENSMUSG00000028702
AA Change: C684Y

DomainStartEndE-ValueType
Pfam:Rad54_N 10 138 7.8e-9 PFAM
DEXDc 149 357 1.66e-41 SMART
Blast:DEXDc 391 427 5e-13 BLAST
low complexity region 441 456 N/A INTRINSIC
HELICc 527 611 1.39e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139147
Meta Mutation Damage Score 0.604 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DEAD-like helicase superfamily, and shares similarity with Saccharomyces cerevisiae Rad54, a protein known to be involved in the homologous recombination and repair of DNA. This protein has been shown to play a role in homologous recombination related repair of DNA double-strand breaks. The binding of this protein to double-strand DNA induces a DNA topological change, which is thought to facilitate homologous DNA paring, and stimulate DNA recombination. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are sensitive to DNA crosslinking agents and to ionizing radiation and show abnormal definitive hematopoiesis following X-ray treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,826,748 R5S possibly damaging Het
Ccdc187 T A 2: 26,280,669 K599I probably damaging Het
Cd38 A C 5: 43,869,089 I72L probably benign Het
Cep19 C T 16: 32,107,065 T97M probably damaging Het
Ces2a T G 8: 104,737,134 D159E probably damaging Het
Dcc G A 18: 71,374,490 A917V probably damaging Het
Dennd6b G A 15: 89,188,663 A196V probably benign Het
Dlgap3 T C 4: 127,214,348 S475P possibly damaging Het
Doc2a C T 7: 126,851,149 P156S probably damaging Het
Elmo1 T A 13: 20,261,552 probably null Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm8251 G A 1: 44,060,991 L316F possibly damaging Het
Klk1b8 C A 7: 43,945,762 probably benign Het
Lmcd1 T A 6: 112,288,007 probably benign Het
Lyst T A 13: 13,698,466 I2750K probably benign Het
Muc4 A G 16: 32,770,292 N2958S possibly damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ppp1r16b G A 2: 158,749,186 V163I probably damaging Het
Prkdc T A 16: 15,768,022 W2475R probably damaging Het
Ralgds T C 2: 28,552,095 L96P probably damaging Het
Rasef T A 4: 73,745,089 H167L probably damaging Het
Sh3bp2 T C 5: 34,555,542 F165L possibly damaging Het
Slc38a9 T C 13: 112,729,215 I482T probably benign Het
Tmprss6 T A 15: 78,459,427 probably null Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttc39c T A 18: 12,728,610 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Vmn2r22 C T 6: 123,637,797 G278D probably damaging Het
Wisp2 G A 2: 163,828,986 V138M probably damaging Het
Yme1l1 G A 2: 23,173,061 A215T probably benign Het
Zmynd15 C T 11: 70,461,068 R38* probably null Het
Other mutations in Rad54l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Rad54l APN 4 116105877 missense probably damaging 1.00
IGL01569:Rad54l APN 4 116098998 missense probably damaging 1.00
IGL02120:Rad54l APN 4 116098984 missense probably benign 0.44
IGL02587:Rad54l APN 4 116105797 missense probably damaging 1.00
IGL02728:Rad54l APN 4 116122949 missense probably benign 0.00
IGL03114:Rad54l APN 4 116098532 missense probably damaging 1.00
R0690:Rad54l UTSW 4 116099750 splice site probably benign
R1179:Rad54l UTSW 4 116111320 missense probably benign 0.14
R1956:Rad54l UTSW 4 116110357 missense probably damaging 0.99
R2875:Rad54l UTSW 4 116101853 missense probably benign 0.00
R2936:Rad54l UTSW 4 116122879 intron probably benign
R4237:Rad54l UTSW 4 116099449 missense probably damaging 1.00
R4801:Rad54l UTSW 4 116122924 missense probably null 0.12
R4802:Rad54l UTSW 4 116122924 missense probably null 0.12
R5106:Rad54l UTSW 4 116099764 intron probably benign
R5644:Rad54l UTSW 4 116098947 missense probably benign
R5684:Rad54l UTSW 4 116100563 missense probably damaging 1.00
R5883:Rad54l UTSW 4 116099046 intron probably benign
R5963:Rad54l UTSW 4 116110387 missense probably damaging 1.00
R6035:Rad54l UTSW 4 116097469 missense probably damaging 1.00
R6035:Rad54l UTSW 4 116097469 missense probably damaging 1.00
R6369:Rad54l UTSW 4 116111189 critical splice donor site probably null
R6863:Rad54l UTSW 4 116099669 missense probably damaging 1.00
R7135:Rad54l UTSW 4 116105830 missense probably damaging 1.00
R7318:Rad54l UTSW 4 116110709 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CTCATGAGAACGCTGGTGGAAG -3'
(R):5'- AGATCTTTCAGCGGCAGAGC -3'

Sequencing Primer
(F):5'- GACGAAGGTGATGGCTGTAGATG -3'
(R):5'- GGAGCGCCACTTTTCTCTTGG -3'
Posted On2015-06-24