Incidental Mutation 'R4344:Tmprss6'
ID324272
Institutional Source Beutler Lab
Gene Symbol Tmprss6
Ensembl Gene ENSMUSG00000016942
Gene Nametransmembrane serine protease 6
Synonymsmatriptase-2, 1300008A22Rik
MMRRC Submission 041101-MU
Accession Numbers

ENSMUST00000017086; MGI: 1919003

Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R4344 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location78439667-78468634 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to A at 78459427 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017086] [ENSMUST00000229124] [ENSMUST00000229516] [ENSMUST00000230159] [ENSMUST00000230226]
Predicted Effect probably null
Transcript: ENSMUST00000017086
SMART Domains Protein: ENSMUSP00000017086
Gene: ENSMUSG00000016942

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Pfam:SEA 88 191 3.2e-13 PFAM
CUB 341 452 3.82e-2 SMART
LDLa 457 489 1.33e-2 SMART
LDLa 490 527 2.31e-9 SMART
LDLa 530 568 1.07e-4 SMART
Tryp_SPc 576 806 3.75e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229124
Predicted Effect probably null
Transcript: ENSMUST00000229516
Predicted Effect probably null
Transcript: ENSMUST00000230159
Predicted Effect probably null
Transcript: ENSMUST00000230226
Meta Mutation Damage Score 0.606 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II transmembrane serine proteinase that is found attached to the cell surface. The encoded protein may be involved in matrix remodeling processes in the liver. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygosity for an inactivating mutation of this gene results in hair loss over the entire body except the face, microcytic anemia and female infertility, all reversible by dietary iron supplementation. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(6) Gene trapped(2) Chemically induced(3)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,826,748 R5S possibly damaging Het
Ccdc187 T A 2: 26,280,669 K599I probably damaging Het
Cd38 A C 5: 43,869,089 I72L probably benign Het
Cep19 C T 16: 32,107,065 T97M probably damaging Het
Ces2a T G 8: 104,737,134 D159E probably damaging Het
Dcc G A 18: 71,374,490 A917V probably damaging Het
Dennd6b G A 15: 89,188,663 A196V probably benign Het
Dlgap3 T C 4: 127,214,348 S475P possibly damaging Het
Doc2a C T 7: 126,851,149 P156S probably damaging Het
Elmo1 T A 13: 20,261,552 probably null Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm8251 G A 1: 44,060,991 L316F possibly damaging Het
Klk1b8 C A 7: 43,945,762 probably benign Het
Lmcd1 T A 6: 112,288,007 probably benign Het
Lyst T A 13: 13,698,466 I2750K probably benign Het
Muc4 A G 16: 32,770,292 N2958S possibly damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ppp1r16b G A 2: 158,749,186 V163I probably damaging Het
Prkdc T A 16: 15,768,022 W2475R probably damaging Het
Rad54l C T 4: 116,097,354 C684Y probably damaging Het
Ralgds T C 2: 28,552,095 L96P probably damaging Het
Rasef T A 4: 73,745,089 H167L probably damaging Het
Sh3bp2 T C 5: 34,555,542 F165L possibly damaging Het
Slc38a9 T C 13: 112,729,215 I482T probably benign Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttc39c T A 18: 12,728,610 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Vmn2r22 C T 6: 123,637,797 G278D probably damaging Het
Wisp2 G A 2: 163,828,986 V138M probably damaging Het
Yme1l1 G A 2: 23,173,061 A215T probably benign Het
Zmynd15 C T 11: 70,461,068 R38* probably null Het
Other mutations in Tmprss6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Tmprss6 APN 15 78442434 missense probably null 1.00
IGL02474:Tmprss6 APN 15 78442336 missense probably damaging 0.99
cubone UTSW 15 78446657 splice site probably null
ekans UTSW 15 78459427 splice site probably null
mask UTSW 15 78464455 intron probably benign
masquerade UTSW 15 78468000 intron probably benign
zorro UTSW 15 78464552 intron probably benign
PIT1430001:Tmprss6 UTSW 15 78440627 missense probably damaging 1.00
R0285:Tmprss6 UTSW 15 78452868 missense probably damaging 0.99
R1857:Tmprss6 UTSW 15 78452552 missense probably damaging 1.00
R2432:Tmprss6 UTSW 15 78465104 splice site probably benign
R4192:Tmprss6 UTSW 15 78446657 splice site probably null
R4226:Tmprss6 UTSW 15 78446699 missense probably damaging 1.00
R4227:Tmprss6 UTSW 15 78446699 missense probably damaging 1.00
R4334:Tmprss6 UTSW 15 78459427 splice site probably null
R4446:Tmprss6 UTSW 15 78452839 missense probably damaging 1.00
R4508:Tmprss6 UTSW 15 78459778 missense probably damaging 1.00
R4643:Tmprss6 UTSW 15 78445356 missense probably damaging 0.98
R4743:Tmprss6 UTSW 15 78443710 missense probably damaging 0.99
R4836:Tmprss6 UTSW 15 78445388 missense probably damaging 1.00
R4859:Tmprss6 UTSW 15 78446677 missense probably damaging 0.99
R4869:Tmprss6 UTSW 15 78443680 unclassified probably null
R5197:Tmprss6 UTSW 15 78454189 missense probably damaging 1.00
R5212:Tmprss6 UTSW 15 78446260 missense probably damaging 0.99
R5225:Tmprss6 UTSW 15 78452507 missense probably damaging 0.97
R5569:Tmprss6 UTSW 15 78440303 missense probably damaging 1.00
R5572:Tmprss6 UTSW 15 78442422 missense probably damaging 1.00
R5669:Tmprss6 UTSW 15 78454956 missense possibly damaging 0.86
R5947:Tmprss6 UTSW 15 78452522 missense probably damaging 1.00
R6800:Tmprss6 UTSW 15 78440257 missense probably damaging 1.00
R6941:Tmprss6 UTSW 15 78446777 missense probably damaging 1.00
R6965:Tmprss6 UTSW 15 78444128 missense probably damaging 1.00
R7334:Tmprss6 UTSW 15 78443817 missense unknown
R7338:Tmprss6 UTSW 15 78459819 missense probably damaging 1.00
X0025:Tmprss6 UTSW 15 78455095 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AAGCACACGTCTACCTGAGC -3'
(R):5'- CCTGGAGCCAAGATAGAAGTC -3'

Sequencing Primer
(F):5'- TACCTGAGCCCCCACCTG -3'
(R):5'- CCAAGATAGAAGTCGAGGGC -3'
Posted On2015-06-24