Incidental Mutation 'R4345:BC005561'
ID324292
Institutional Source Beutler Lab
Gene Symbol BC005561
Ensembl Gene ENSMUSG00000079065
Gene NamecDNA sequence BC005561
Synonyms
MMRRC Submission 041666-MU
Accession Numbers

Genbank: NM_001166581; MGI: 3040669

Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R4345 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location104508352-104522611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104521449 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1279 (E1279G)
Ref Sequence ENSEMBL: ENSMUSP00000130629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096452]
Predicted Effect probably benign
Transcript: ENSMUST00000096452
AA Change: E1279G

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130629
Gene: ENSMUSG00000079065
AA Change: E1279G

DomainStartEndE-ValueType
Pfam:THOC2_N 10 424 3.5e-65 PFAM
Pfam:THOC2_N 415 566 5.8e-32 PFAM
Pfam:Thoc2 568 643 8.3e-40 PFAM
low complexity region 729 747 N/A INTRINSIC
Pfam:Tho2 873 1173 1.1e-105 PFAM
low complexity region 1251 1262 N/A INTRINSIC
low complexity region 1266 1283 N/A INTRINSIC
coiled coil region 1310 1335 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
low complexity region 1459 1482 N/A INTRINSIC
low complexity region 1524 1543 N/A INTRINSIC
low complexity region 1561 1569 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200034
Meta Mutation Damage Score 0.1424 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap2 T C 12: 21,230,831 W449R probably damaging Het
Astn1 T A 1: 158,502,032 probably null Het
C3ar1 T C 6: 122,850,700 D186G probably damaging Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Foxp4 G A 17: 47,874,648 T500M unknown Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gramd4 T C 15: 86,134,893 S581P probably damaging Het
Heatr5b A T 17: 78,760,511 V1816E possibly damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Il1r1 A G 1: 40,297,924 D224G probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lactb2 T A 1: 13,660,350 Y34F probably damaging Het
Lepr G A 4: 101,765,152 probably null Het
Loxhd1 A G 18: 77,399,001 I1261V possibly damaging Het
Map4k3 A G 17: 80,597,551 probably null Het
Mcee T C 7: 64,411,938 L109P probably damaging Het
Mier3 A G 13: 111,705,283 D124G probably damaging Het
Mrpl43 T C 19: 45,006,110 Y64C probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nsd3 G C 8: 25,641,317 G233R probably benign Het
Olfr1065 T A 2: 86,445,845 I46F probably damaging Het
Olfr320 A G 11: 58,683,945 D24G possibly damaging Het
Pdzd8 T C 19: 59,300,128 T947A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Pno1 A G 11: 17,209,095 S158P possibly damaging Het
Prr14l A G 5: 32,828,576 S1192P probably damaging Het
Setbp1 T A 18: 79,086,579 E146V probably damaging Het
Slc9a5 T C 8: 105,349,455 S27P probably benign Het
Sri G T 5: 8,059,427 probably null Het
Stard9 G A 2: 120,701,946 V2895I probably benign Het
Tgfbrap1 T C 1: 43,056,706 D524G probably benign Het
Them4 A G 3: 94,329,865 T211A possibly damaging Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttl T C 2: 129,075,858 L80P probably damaging Het
Ttn G T 2: 76,756,316 N13423K possibly damaging Het
Usp10 T A 8: 119,954,814 L670Q probably damaging Het
Usp4 T A 9: 108,368,023 probably benign Het
Vmn1r72 T A 7: 11,670,036 T162S possibly damaging Het
Zmym5 T C 14: 56,796,626 N376S probably benign Het
Zswim6 G T 13: 107,726,931 noncoding transcript Het
Other mutations in BC005561
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:BC005561 APN 5 104520500 missense probably damaging 1.00
IGL01024:BC005561 APN 5 104521746 missense probably benign 0.02
IGL01133:BC005561 APN 5 104517662 missense probably benign
IGL01564:BC005561 APN 5 104520663 missense probably benign 0.12
IGL01727:BC005561 APN 5 104519513 missense probably benign 0.01
IGL02086:BC005561 APN 5 104519001 missense possibly damaging 0.49
IGL02153:BC005561 APN 5 104521083 missense probably benign 0.02
IGL02256:BC005561 APN 5 104520283 nonsense probably null
IGL02436:BC005561 APN 5 104521155 missense probably benign 0.10
IGL02969:BC005561 APN 5 104519343 missense probably benign 0.01
IGL03275:BC005561 APN 5 104518277 missense probably benign 0.00
IGL03357:BC005561 APN 5 104520468 missense probably damaging 1.00
F2404:BC005561 UTSW 5 104520230 missense possibly damaging 0.83
R0318:BC005561 UTSW 5 104517753 missense probably benign 0.00
R0349:BC005561 UTSW 5 104519976 missense possibly damaging 0.85
R0454:BC005561 UTSW 5 104518211 missense probably benign 0.45
R0742:BC005561 UTSW 5 104522154 missense probably benign 0.00
R0842:BC005561 UTSW 5 104519200 missense possibly damaging 0.81
R0882:BC005561 UTSW 5 104519009 missense probably benign 0.05
R1123:BC005561 UTSW 5 104518470 missense probably damaging 1.00
R1171:BC005561 UTSW 5 104520903 missense possibly damaging 0.49
R1205:BC005561 UTSW 5 104520213 missense probably benign 0.28
R1261:BC005561 UTSW 5 104520635 missense probably damaging 0.98
R1432:BC005561 UTSW 5 104518104 missense probably damaging 1.00
R1447:BC005561 UTSW 5 104522204 missense possibly damaging 0.89
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1584:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1636:BC005561 UTSW 5 104520750 missense probably damaging 0.99
R1686:BC005561 UTSW 5 104519923 nonsense probably null
R1698:BC005561 UTSW 5 104520510 missense probably benign 0.09
R1816:BC005561 UTSW 5 104517834 missense probably benign 0.16
R1903:BC005561 UTSW 5 104518330 missense probably benign 0.00
R2096:BC005561 UTSW 5 104519969 missense possibly damaging 0.95
R2146:BC005561 UTSW 5 104518991 missense probably benign
R2226:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2227:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2383:BC005561 UTSW 5 104518988 missense probably benign 0.23
R2656:BC005561 UTSW 5 104519315 missense probably benign 0.05
R3982:BC005561 UTSW 5 104521023 missense probably benign 0.29
R3983:BC005561 UTSW 5 104521023 missense probably benign 0.29
R4115:BC005561 UTSW 5 104519433 missense probably damaging 1.00
R4697:BC005561 UTSW 5 104522240 missense probably benign 0.00
R4711:BC005561 UTSW 5 104519661 missense probably damaging 0.98
R4742:BC005561 UTSW 5 104518857 missense probably benign 0.17
R4758:BC005561 UTSW 5 104520399 missense possibly damaging 0.48
R4863:BC005561 UTSW 5 104517750 missense possibly damaging 0.89
R4867:BC005561 UTSW 5 104521002 missense possibly damaging 0.91
R5024:BC005561 UTSW 5 104522258 missense possibly damaging 0.68
R5114:BC005561 UTSW 5 104519876 missense probably damaging 0.99
R5117:BC005561 UTSW 5 104520255 missense probably damaging 1.00
R5289:BC005561 UTSW 5 104519657 missense probably benign 0.03
R5341:BC005561 UTSW 5 104518076 missense probably damaging 1.00
R5420:BC005561 UTSW 5 104518359 missense probably damaging 0.99
R5421:BC005561 UTSW 5 104518395 missense probably benign 0.01
R5422:BC005561 UTSW 5 104519646 missense probably damaging 0.98
R5606:BC005561 UTSW 5 104521878 missense probably benign 0.00
R5939:BC005561 UTSW 5 104519207 missense possibly damaging 0.56
R6104:BC005561 UTSW 5 104518218 missense probably damaging 1.00
R6169:BC005561 UTSW 5 104518396 missense probably benign 0.00
R6316:BC005561 UTSW 5 104519729 missense probably damaging 1.00
R6352:BC005561 UTSW 5 104520198 missense probably benign 0.11
R6408:BC005561 UTSW 5 104518777 missense probably benign 0.19
R6458:BC005561 UTSW 5 104522303 missense probably benign 0.02
R6722:BC005561 UTSW 5 104520279 missense probably damaging 0.99
R6789:BC005561 UTSW 5 104517689 missense probably benign 0.00
R7214:BC005561 UTSW 5 104522363 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTGCCTTCATCTATAGGAAG -3'
(R):5'- GGCAACAATGATCCTGAATTTCTC -3'

Sequencing Primer
(F):5'- CTGCCTTCATCTATAGGAAGTATGTG -3'
(R):5'- ATGATCCTGAATTTCTCATCTTTAGC -3'
Posted On2015-06-24