Incidental Mutation 'R4345:Heatr5b'
ID324313
Institutional Source Beutler Lab
Gene Symbol Heatr5b
Ensembl Gene ENSMUSG00000039414
Gene NameHEAT repeat containing 5B
Synonyms2010013B10Rik, A230048G03Rik, D330050P16Rik
MMRRC Submission 041666-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R4345 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location78752906-78835381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78760511 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1816 (V1816E)
Ref Sequence ENSEMBL: ENSMUSP00000094882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097281
AA Change: V1816E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414
AA Change: V1816E

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Meta Mutation Damage Score 0.298 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap2 T C 12: 21,230,831 W449R probably damaging Het
Astn1 T A 1: 158,502,032 probably null Het
BC005561 A G 5: 104,521,449 E1279G probably benign Het
C3ar1 T C 6: 122,850,700 D186G probably damaging Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Foxp4 G A 17: 47,874,648 T500M unknown Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gramd4 T C 15: 86,134,893 S581P probably damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Il1r1 A G 1: 40,297,924 D224G probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lactb2 T A 1: 13,660,350 Y34F probably damaging Het
Lepr G A 4: 101,765,152 probably null Het
Loxhd1 A G 18: 77,399,001 I1261V possibly damaging Het
Map4k3 A G 17: 80,597,551 probably null Het
Mcee T C 7: 64,411,938 L109P probably damaging Het
Mier3 A G 13: 111,705,283 D124G probably damaging Het
Mrpl43 T C 19: 45,006,110 Y64C probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nsd3 G C 8: 25,641,317 G233R probably benign Het
Olfr1065 T A 2: 86,445,845 I46F probably damaging Het
Olfr320 A G 11: 58,683,945 D24G possibly damaging Het
Pdzd8 T C 19: 59,300,128 T947A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Pno1 A G 11: 17,209,095 S158P possibly damaging Het
Prr14l A G 5: 32,828,576 S1192P probably damaging Het
Setbp1 T A 18: 79,086,579 E146V probably damaging Het
Slc9a5 T C 8: 105,349,455 S27P probably benign Het
Sri G T 5: 8,059,427 probably null Het
Stard9 G A 2: 120,701,946 V2895I probably benign Het
Tgfbrap1 T C 1: 43,056,706 D524G probably benign Het
Them4 A G 3: 94,329,865 T211A possibly damaging Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttl T C 2: 129,075,858 L80P probably damaging Het
Ttn G T 2: 76,756,316 N13423K possibly damaging Het
Usp10 T A 8: 119,954,814 L670Q probably damaging Het
Usp4 T A 9: 108,368,023 probably benign Het
Vmn1r72 T A 7: 11,670,036 T162S possibly damaging Het
Zmym5 T C 14: 56,796,626 N376S probably benign Het
Zswim6 G T 13: 107,726,931 noncoding transcript Het
Other mutations in Heatr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Heatr5b APN 17 78803434 missense probably damaging 1.00
IGL00418:Heatr5b APN 17 78753141 missense probably damaging 1.00
IGL00786:Heatr5b APN 17 78824634 missense possibly damaging 0.95
IGL00840:Heatr5b APN 17 78765437 missense probably damaging 1.00
IGL01362:Heatr5b APN 17 78816338 splice site probably benign
IGL01419:Heatr5b APN 17 78796510 missense probably benign 0.19
IGL01447:Heatr5b APN 17 78829597 missense probably benign 0.00
IGL01591:Heatr5b APN 17 78808472 missense probably benign 0.01
IGL01743:Heatr5b APN 17 78824640 nonsense probably null
IGL01860:Heatr5b APN 17 78808480 missense probably damaging 0.98
IGL01862:Heatr5b APN 17 78796485 missense possibly damaging 0.96
IGL01984:Heatr5b APN 17 78796497 missense possibly damaging 0.63
IGL02045:Heatr5b APN 17 78808426 missense probably damaging 1.00
IGL02097:Heatr5b APN 17 78817514 missense probably damaging 1.00
IGL02168:Heatr5b APN 17 78831591 unclassified probably benign
IGL02399:Heatr5b APN 17 78827967 missense probably damaging 0.99
IGL02540:Heatr5b APN 17 78773572 missense probably damaging 1.00
IGL02719:Heatr5b APN 17 78815540 missense probably damaging 1.00
IGL02824:Heatr5b APN 17 78773680 missense probably damaging 1.00
IGL02965:Heatr5b APN 17 78753073 missense probably benign 0.37
IGL03032:Heatr5b APN 17 78760499 missense probably benign 0.45
IGL03243:Heatr5b APN 17 78763080 splice site probably benign
IGL03259:Heatr5b APN 17 78791556 missense probably damaging 1.00
IGL03349:Heatr5b APN 17 78755320 missense probably benign 0.01
R0124:Heatr5b UTSW 17 78826217 splice site probably benign
R0285:Heatr5b UTSW 17 78808453 missense probably benign 0.05
R0335:Heatr5b UTSW 17 78827946 missense probably benign 0.15
R0412:Heatr5b UTSW 17 78820854 missense probably benign 0.04
R0601:Heatr5b UTSW 17 78768545 missense probably benign
R0725:Heatr5b UTSW 17 78796396 missense probably benign 0.03
R1178:Heatr5b UTSW 17 78813269 missense probably damaging 1.00
R1444:Heatr5b UTSW 17 78753193 missense probably benign 0.17
R1444:Heatr5b UTSW 17 78755427 splice site probably benign
R1453:Heatr5b UTSW 17 78817563 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1506:Heatr5b UTSW 17 78753147 missense probably damaging 1.00
R1819:Heatr5b UTSW 17 78791511 missense probably damaging 0.98
R1835:Heatr5b UTSW 17 78773563 missense probably damaging 1.00
R1837:Heatr5b UTSW 17 78820751 missense possibly damaging 0.54
R1934:Heatr5b UTSW 17 78795918 missense possibly damaging 0.93
R2014:Heatr5b UTSW 17 78814184 missense probably damaging 1.00
R2037:Heatr5b UTSW 17 78829505 nonsense probably null
R2154:Heatr5b UTSW 17 78831444 missense probably benign 0.00
R2190:Heatr5b UTSW 17 78801756 missense probably damaging 1.00
R2191:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R2413:Heatr5b UTSW 17 78756861 critical splice donor site probably null
R3424:Heatr5b UTSW 17 78768404 missense possibly damaging 0.58
R3607:Heatr5b UTSW 17 78834217 missense probably damaging 1.00
R3759:Heatr5b UTSW 17 78824540 missense possibly damaging 0.94
R3761:Heatr5b UTSW 17 78829642 missense probably damaging 1.00
R4127:Heatr5b UTSW 17 78753174 missense possibly damaging 0.48
R4242:Heatr5b UTSW 17 78756922 missense probably benign 0.00
R4534:Heatr5b UTSW 17 78810596 missense possibly damaging 0.91
R4623:Heatr5b UTSW 17 78795119 missense possibly damaging 0.52
R4654:Heatr5b UTSW 17 78820701 missense possibly damaging 0.95
R4939:Heatr5b UTSW 17 78762260 missense probably benign 0.18
R4960:Heatr5b UTSW 17 78831584 missense probably benign 0.01
R5037:Heatr5b UTSW 17 78824510 missense probably benign 0.00
R5051:Heatr5b UTSW 17 78795274 missense probably damaging 1.00
R5153:Heatr5b UTSW 17 78795107 nonsense probably null
R5328:Heatr5b UTSW 17 78826362 missense possibly damaging 0.94
R5346:Heatr5b UTSW 17 78827986 missense probably benign 0.44
R5426:Heatr5b UTSW 17 78773713 missense probably damaging 1.00
R5470:Heatr5b UTSW 17 78821579 splice site probably null
R5472:Heatr5b UTSW 17 78801660 missense probably damaging 1.00
R5553:Heatr5b UTSW 17 78753351 splice site probably null
R5706:Heatr5b UTSW 17 78766875 splice site probably null
R5804:Heatr5b UTSW 17 78831522 missense probably damaging 0.97
R5978:Heatr5b UTSW 17 78806036 missense probably damaging 0.99
R6122:Heatr5b UTSW 17 78813173 missense possibly damaging 0.96
R6153:Heatr5b UTSW 17 78831441 missense possibly damaging 0.56
R6220:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R6221:Heatr5b UTSW 17 78766954 missense probably benign 0.05
R6255:Heatr5b UTSW 17 78803434 missense probably damaging 1.00
R6291:Heatr5b UTSW 17 78762097 missense probably benign 0.08
R6455:Heatr5b UTSW 17 78753073 missense probably benign 0.37
R6524:Heatr5b UTSW 17 78814106 missense possibly damaging 0.94
R6575:Heatr5b UTSW 17 78762989 missense probably damaging 1.00
R6899:Heatr5b UTSW 17 78803509 missense probably benign 0.03
R7084:Heatr5b UTSW 17 78810563 missense possibly damaging 0.68
R7138:Heatr5b UTSW 17 78827988 missense probably damaging 1.00
R7148:Heatr5b UTSW 17 78831434 missense probably damaging 0.99
R7382:Heatr5b UTSW 17 78803507 missense possibly damaging 0.64
R7420:Heatr5b UTSW 17 78808480 missense probably damaging 1.00
R7436:Heatr5b UTSW 17 78768533 missense probably benign
X0022:Heatr5b UTSW 17 78760545 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GGACAGCCAGGACTACACAG -3'
(R):5'- TGTGAAGCCAGCCTGTACAC -3'

Sequencing Primer
(F):5'- GGACTACACAGAGAAACCCTGTCTC -3'
(R):5'- ATCATGAGCCCTTAACTGAGG -3'
Posted On2015-06-24