Incidental Mutation 'R4327:Tiam1'
ID324441
Institutional Source Beutler Lab
Gene Symbol Tiam1
Ensembl Gene ENSMUSG00000002489
Gene NameT cell lymphoma invasion and metastasis 1
SynonymsD16Ium10e, D16Ium10
MMRRC Submission 041097-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4327 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location89787111-90143769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89855891 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 781 (V781A)
Ref Sequence ENSEMBL: ENSMUSP00000132137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002588] [ENSMUST00000114122] [ENSMUST00000114124] [ENSMUST00000163370]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002588
AA Change: V781A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000002588
Gene: ENSMUSG00000002489
AA Change: V781A

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
PH 434 549 1.32e-13 SMART
low complexity region 573 586 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
RBD 765 832 1.76e-22 SMART
PDZ 856 928 1.15e-5 SMART
low complexity region 1013 1028 N/A INTRINSIC
RhoGEF 1044 1233 1.42e-63 SMART
PH 1262 1397 9.58e-2 SMART
low complexity region 1445 1454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114122
SMART Domains Protein: ENSMUSP00000109757
Gene: ENSMUSG00000002489

DomainStartEndE-ValueType
PDZ 44 116 1.15e-5 SMART
low complexity region 201 216 N/A INTRINSIC
RhoGEF 232 421 1.42e-63 SMART
PH 450 585 9.58e-2 SMART
low complexity region 633 642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114124
SMART Domains Protein: ENSMUSP00000109759
Gene: ENSMUSG00000002489

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
PH 434 549 1.32e-13 SMART
low complexity region 573 586 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
RBD 765 832 1.76e-22 SMART
PDZ 856 928 1.15e-5 SMART
low complexity region 1013 1028 N/A INTRINSIC
RhoGEF 1044 1233 1.42e-63 SMART
PH 1262 1397 9.58e-2 SMART
low complexity region 1445 1454 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163370
AA Change: V781A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132137
Gene: ENSMUSG00000002489
AA Change: V781A

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
PH 434 549 1.32e-13 SMART
low complexity region 573 586 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
RBD 765 832 1.76e-22 SMART
PDZ 856 928 1.15e-5 SMART
low complexity region 1013 1028 N/A INTRINSIC
RhoGEF 1044 1233 1.42e-63 SMART
PH 1262 1397 9.58e-2 SMART
low complexity region 1445 1454 N/A INTRINSIC
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null allele display resistance to chemically-induced tumors, however, tumors that do develop progress to malignancy. Mice homozygous for a gene trap allele display anencephaly, exencephaly and/or neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,182,505 D55G possibly damaging Het
3110043O21Rik T A 4: 35,225,985 probably benign Het
Alcam T C 16: 52,253,216 N549S possibly damaging Het
Arap2 A T 5: 62,621,863 H1461Q possibly damaging Het
Arhgef12 C A 9: 42,975,229 E1152* probably null Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atp1a3 A G 7: 24,987,631 probably benign Het
Bcl2l1 A G 2: 152,782,179 V223A probably benign Het
Cela3b G T 4: 137,423,931 A137E probably benign Het
Col13a1 T C 10: 61,863,979 T476A unknown Het
Col16a1 T C 4: 130,094,551 probably null Het
Ctcfl G A 2: 173,113,506 probably benign Het
Cyp2j8 T A 4: 96,507,329 T20S probably benign Het
Fastkd2 A G 1: 63,752,357 K675E probably benign Het
Fsip2 A T 2: 82,987,059 I4379F probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Hmgxb3 A T 18: 61,167,539 M155K probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kcnn1 A T 8: 70,852,663 V301E probably damaging Het
Kcnq4 T C 4: 120,711,364 E385G probably benign Het
Klhl28 G A 12: 64,950,178 A463V probably damaging Het
Lhb A G 7: 45,420,959 R3G possibly damaging Het
Lingo2 T A 4: 35,708,462 D506V probably damaging Het
Macf1 C T 4: 123,382,212 A4176T probably damaging Het
March6 C T 15: 31,498,741 E137K probably benign Het
Med12l T C 3: 59,265,267 S1813P probably benign Het
Mpp3 T C 11: 102,023,511 probably benign Het
Muc2 A C 7: 141,695,334 S479R probably damaging Het
Olfr1145 G T 2: 87,810,152 V111L probably benign Het
Olfr31 T A 14: 14,328,193 F27L probably damaging Het
Olfr664 G A 7: 104,733,626 T246I probably damaging Het
Olfr743 T A 14: 50,533,514 I34N probably benign Het
Pafah1b1 T C 11: 74,682,240 T333A probably benign Het
Palm G A 10: 79,807,686 G83S probably benign Het
Pcdhb9 A T 18: 37,401,822 S290C probably benign Het
Pcdhb9 G T 18: 37,401,823 S290I probably benign Het
Pdgfrb A T 18: 61,071,720 I551F possibly damaging Het
Pex26 A T 6: 121,187,414 E172V probably damaging Het
Pitrm1 A G 13: 6,579,773 probably benign Het
Ptprs C A 17: 56,447,468 A191S possibly damaging Het
Rdm1 T A 11: 101,630,908 V92E probably damaging Het
Scn7a A G 2: 66,737,471 F260L probably damaging Het
Serpinb3a T A 1: 107,051,770 M1L probably damaging Het
Sh3d19 T C 3: 86,123,713 I728T probably benign Het
Sin3a T C 9: 57,095,358 L178P probably damaging Het
Slc13a1 A G 6: 24,103,479 V355A probably benign Het
St7 G A 6: 17,819,288 V64M probably damaging Het
Tcf25 T A 8: 123,401,143 L622* probably null Het
Tigd2 C A 6: 59,210,577 T143K probably benign Het
Tmem107 G T 11: 69,071,475 probably null Het
Tmem161b G A 13: 84,251,240 G5D probably damaging Het
Tonsl G A 15: 76,639,716 A28V probably benign Het
Treml4 T C 17: 48,274,389 Y222H probably damaging Het
Trp53bp1 A T 2: 121,256,650 V175D probably damaging Het
Zfp184 T C 13: 21,959,902 Y593H probably damaging Het
Zfp286 A G 11: 62,780,018 C410R probably damaging Het
Zfp934 T G 13: 62,517,559 N312H probably benign Het
Other mutations in Tiam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Tiam1 APN 16 89794739 missense probably damaging 1.00
IGL01356:Tiam1 APN 16 89837788 missense probably damaging 0.99
IGL01583:Tiam1 APN 16 89789280 missense probably damaging 1.00
IGL01626:Tiam1 APN 16 89812968 missense probably damaging 1.00
IGL01802:Tiam1 APN 16 89898372 missense possibly damaging 0.94
IGL01818:Tiam1 APN 16 89867704 missense probably damaging 1.00
IGL02146:Tiam1 APN 16 89849681 missense probably benign 0.20
IGL02329:Tiam1 APN 16 89800036 missense probably benign 0.08
IGL02341:Tiam1 APN 16 89898369 missense probably damaging 1.00
IGL02622:Tiam1 APN 16 89798700 missense possibly damaging 0.59
F5770:Tiam1 UTSW 16 89865271 missense probably damaging 1.00
PIT4515001:Tiam1 UTSW 16 89860242 missense probably damaging 0.99
R0130:Tiam1 UTSW 16 89897754 missense probably benign 0.01
R0143:Tiam1 UTSW 16 89898200 missense probably benign 0.01
R0158:Tiam1 UTSW 16 89793001 critical splice donor site probably benign
R0413:Tiam1 UTSW 16 89809365 splice site probably benign
R0449:Tiam1 UTSW 16 89837827 missense possibly damaging 0.75
R0520:Tiam1 UTSW 16 89817951 splice site probably benign
R0667:Tiam1 UTSW 16 89897984 missense probably damaging 1.00
R0787:Tiam1 UTSW 16 89789561 missense probably damaging 1.00
R1355:Tiam1 UTSW 16 89898221 missense probably benign 0.09
R1370:Tiam1 UTSW 16 89898221 missense probably benign 0.09
R1534:Tiam1 UTSW 16 89867508 critical splice donor site probably null
R1769:Tiam1 UTSW 16 89860279 missense probably damaging 1.00
R1831:Tiam1 UTSW 16 89860294 missense probably benign 0.01
R1913:Tiam1 UTSW 16 89798694 missense probably damaging 1.00
R2022:Tiam1 UTSW 16 89877187 missense probably benign
R2140:Tiam1 UTSW 16 89849645 splice site probably benign
R2383:Tiam1 UTSW 16 89798684 missense probably benign 0.29
R2697:Tiam1 UTSW 16 89793164 missense probably benign 0.00
R4118:Tiam1 UTSW 16 89877033 splice site probably null
R4693:Tiam1 UTSW 16 89843282 missense possibly damaging 0.87
R5104:Tiam1 UTSW 16 89818041 missense probably benign 0.00
R5412:Tiam1 UTSW 16 89884865 missense possibly damaging 0.52
R5426:Tiam1 UTSW 16 89865392 missense possibly damaging 0.58
R5600:Tiam1 UTSW 16 89865365 missense probably damaging 1.00
R5842:Tiam1 UTSW 16 89855999 missense probably benign
R5986:Tiam1 UTSW 16 89789186 missense probably benign 0.31
R6077:Tiam1 UTSW 16 89798030 critical splice donor site probably null
R6419:Tiam1 UTSW 16 89898024 nonsense probably null
R6525:Tiam1 UTSW 16 89858597 critical splice donor site probably null
R6950:Tiam1 UTSW 16 89860204 critical splice donor site probably null
R7127:Tiam1 UTSW 16 89860260 missense probably damaging 1.00
R7197:Tiam1 UTSW 16 89884938 missense probably damaging 1.00
R7249:Tiam1 UTSW 16 89843255 missense probably damaging 1.00
V7582:Tiam1 UTSW 16 89865271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGCATGTCCAGCTTCCTC -3'
(R):5'- TCATTAGACATGGACGGCTGC -3'

Sequencing Primer
(F):5'- TGCCCACAGGTGCTTGAGAAG -3'
(R):5'- GGCTGCAGCTCTGATGACTTC -3'
Posted On2015-06-24