Incidental Mutation 'R0010:Spta1'
ID32448
Institutional Source Beutler Lab
Gene Symbol Spta1
Ensembl Gene ENSMUSG00000026532
Gene Namespectrin alpha, erythrocytic 1
Synonymserythroid, Spna-1, ihj, Spna1
MMRRC Submission 038305-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R0010 (G1)
Quality Score188
Status Validated (trace)
Chromosome1
Chromosomal Location174172776-174248450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 174217943 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1556 (V1556I)
Ref Sequence ENSEMBL: ENSMUSP00000027817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027817]
Predicted Effect probably benign
Transcript: ENSMUST00000027817
AA Change: V1556I

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532
AA Change: V1556I

DomainStartEndE-ValueType
SPEC 55 153 3.62e-11 SMART
SPEC 159 259 1.84e-26 SMART
SPEC 265 365 1.56e-24 SMART
SPEC 371 471 8.35e-25 SMART
SPEC 477 577 1.19e-29 SMART
SPEC 583 682 2.43e-26 SMART
SPEC 688 788 1.3e-26 SMART
SPEC 794 894 1.66e-28 SMART
SPEC 900 1077 5.03e-19 SMART
SH3 978 1033 2.98e-15 SMART
SPEC 1083 1178 2.57e-16 SMART
SPEC 1184 1284 1.15e-27 SMART
SPEC 1290 1390 7.05e-23 SMART
SPEC 1396 1495 6.04e-22 SMART
SPEC 1501 1602 1.15e-27 SMART
SPEC 1608 1708 5.46e-29 SMART
SPEC 1714 1814 1.08e-32 SMART
SPEC 1820 1921 2.17e-23 SMART
SPEC 1927 2028 2.19e-19 SMART
SPEC 2042 2142 3.87e-11 SMART
SPEC 2156 2253 9.77e-8 SMART
low complexity region 2307 2318 N/A INTRINSIC
efhand_Ca_insen 2346 2414 2.37e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156092
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,205,609 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Bbs7 T C 3: 36,607,717 probably null Het
BC037034 T C 5: 138,260,293 probably null Het
Cacna1h T C 17: 25,380,844 K1566E probably damaging Het
Ccdc73 C T 2: 104,980,987 probably benign Het
Cd74 A T 18: 60,803,896 probably benign Het
Cd74 A T 18: 60,809,071 H124L probably benign Het
Cdk5rap2 T C 4: 70,243,459 E270G probably benign Het
Ces2a G A 8: 104,741,396 D520N probably benign Het
Cldnd1 T A 16: 58,731,259 probably benign Het
Cox17 T A 16: 38,347,170 C24S possibly damaging Het
Cyp2b9 T A 7: 26,186,753 probably benign Het
Dennd4a T C 9: 64,896,715 L1112P probably benign Het
Dennd4c T C 4: 86,781,577 S222P probably damaging Het
Dhx37 T A 5: 125,431,616 Q85L probably benign Het
Egfem1 G T 3: 29,582,919 C192F probably damaging Het
Eif3f A T 7: 108,941,005 N336Y possibly damaging Het
Evc2 T A 5: 37,417,449 L1016Q probably damaging Het
Fam114a2 G T 11: 57,514,156 T40N probably damaging Het
Fam135b T C 15: 71,622,032 K16R probably damaging Het
Fcho1 A G 8: 71,709,999 Y725H probably damaging Het
Frem1 T C 4: 83,000,098 I536V probably benign Het
Ginm1 T C 10: 7,775,374 probably benign Het
Glrb A T 3: 80,860,315 probably benign Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gm10320 T C 13: 98,489,546 Y110C probably damaging Het
Gm20388 G A 8: 122,270,598 probably benign Het
Gm3985 A T 8: 32,942,456 noncoding transcript Het
Gm5422 A G 10: 31,249,754 noncoding transcript Het
Igkv6-29 A T 6: 70,138,770 probably benign Het
Inpp5d G A 1: 87,697,546 probably null Het
Itpr3 T G 17: 27,120,977 V2610G probably damaging Het
Kmt5c T A 7: 4,746,208 M88K probably benign Het
Lrp12 C T 15: 39,878,276 A367T probably damaging Het
Ltbp1 A G 17: 75,363,391 T1476A probably damaging Het
Mcoln2 C T 3: 146,183,561 T374M probably damaging Het
Milr1 T G 11: 106,767,003 *209G probably null Het
Mitf A G 6: 97,807,281 K33R probably benign Het
Mon2 A C 10: 123,032,694 S485A probably damaging Het
Mpdu1 C T 11: 69,658,841 G47R probably damaging Het
Ms4a4d A G 19: 11,554,826 N112S probably damaging Het
Mybpc3 G A 2: 91,134,833 W1082* probably null Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Naa15 A T 3: 51,436,213 probably null Het
Nav3 A G 10: 109,823,226 probably benign Het
Nek7 T A 1: 138,544,204 Q66L possibly damaging Het
Nktr G A 9: 121,741,166 probably benign Het
Nlgn1 G T 3: 25,435,842 probably benign Het
Npr1 T C 3: 90,454,832 E1002G probably damaging Het
Nup133 A T 8: 123,904,579 I1072N probably damaging Het
Oc90 C T 15: 65,876,548 C371Y probably damaging Het
Olfr835 A T 9: 19,035,322 L66F probably damaging Het
Olfr901 A T 9: 38,430,920 I213F possibly damaging Het
Olfr994 A T 2: 85,429,895 D311E probably benign Het
Pradc1 A T 6: 85,447,231 N44K probably damaging Het
Pradc1 T C 6: 85,447,620 D116G probably damaging Het
Ptprk G A 10: 28,585,969 C91Y probably damaging Het
Pus7 T C 5: 23,747,845 I491V probably benign Het
Rock1 T A 18: 10,084,380 D951V probably damaging Het
Scgb2b26 T A 7: 33,944,349 E55D probably damaging Het
Scn8a T C 15: 101,013,573 V958A probably damaging Het
Sec14l1 T C 11: 117,143,770 probably benign Het
Sec24c A G 14: 20,689,261 probably benign Het
Sema6b C T 17: 56,124,105 E853K probably benign Het
Sgk1 G A 10: 21,997,438 probably null Het
Shprh C T 10: 11,151,931 T94I probably benign Het
Slc16a3 T C 11: 120,956,705 S240P probably benign Het
Slc5a8 T C 10: 88,886,590 V95A probably benign Het
Smg1 A T 7: 118,171,859 probably benign Het
Svs1 A T 6: 48,988,906 H616L probably damaging Het
Trappc4 G A 9: 44,405,231 probably benign Het
Tubgcp6 A G 15: 89,103,183 S1188P probably benign Het
Txlna T G 4: 129,629,086 D487A probably benign Het
Ube2d2b T C 5: 107,830,636 F51S possibly damaging Het
Vmn2r6 G A 3: 64,559,545 Q178* probably null Het
Wdfy3 T C 5: 101,848,349 T3234A probably damaging Het
Ylpm1 C A 12: 85,029,026 Q384K probably damaging Het
Zbtb41 T G 1: 139,423,530 V127G probably damaging Het
Zfp605 T A 5: 110,127,534 C173S probably benign Het
Zfp608 A T 18: 54,895,214 probably benign Het
Zhx2 T C 15: 57,821,274 V13A possibly damaging Het
Other mutations in Spta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Spta1 APN 1 174208390 nonsense probably null
IGL01095:Spta1 APN 1 174213485 missense probably benign 0.02
IGL01144:Spta1 APN 1 174187263 missense probably benign 0.05
IGL01455:Spta1 APN 1 174203311 missense possibly damaging 0.78
IGL01541:Spta1 APN 1 174217159 missense probably benign 0.03
IGL01613:Spta1 APN 1 174208394 missense probably damaging 1.00
IGL01804:Spta1 APN 1 174244180 missense probably benign 0.42
IGL01859:Spta1 APN 1 174174372 missense probably damaging 1.00
IGL01898:Spta1 APN 1 174213862 missense probably benign 0.00
IGL02106:Spta1 APN 1 174203294 missense probably benign 0.02
IGL02166:Spta1 APN 1 174190231 missense probably damaging 1.00
IGL02224:Spta1 APN 1 174217689 critical splice donor site probably benign
IGL02318:Spta1 APN 1 174174463 missense possibly damaging 0.51
IGL02392:Spta1 APN 1 174218814 missense probably damaging 0.96
IGL02852:Spta1 APN 1 174244110 missense probably benign 0.24
IGL02861:Spta1 APN 1 174211598 missense probably damaging 1.00
IGL02982:Spta1 APN 1 174187288 missense probably benign 0.00
IGL03057:Spta1 APN 1 174181058 missense probably benign 0.19
IGL03215:Spta1 APN 1 174218743 missense probably damaging 1.00
IGL03263:Spta1 APN 1 174213918 missense probably damaging 0.99
IGL03272:Spta1 APN 1 174214144 missense probably benign 0.08
H8786:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0078:Spta1 UTSW 1 174207032 splice site probably benign
R0172:Spta1 UTSW 1 174230786 missense probably damaging 1.00
R0206:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0208:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0276:Spta1 UTSW 1 174217894 missense probably damaging 1.00
R0288:Spta1 UTSW 1 174243179 missense probably damaging 0.99
R0323:Spta1 UTSW 1 174218451 missense probably damaging 1.00
R0454:Spta1 UTSW 1 174213942 missense probably damaging 1.00
R0508:Spta1 UTSW 1 174224457 missense probably damaging 1.00
R0698:Spta1 UTSW 1 174181104 missense probably damaging 1.00
R0751:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R0925:Spta1 UTSW 1 174174426 missense possibly damaging 0.85
R0941:Spta1 UTSW 1 174245205 unclassified probably benign
R1131:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R1171:Spta1 UTSW 1 174211614 nonsense probably null
R1184:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R1401:Spta1 UTSW 1 174222684 missense probably damaging 1.00
R1489:Spta1 UTSW 1 174231325 missense probably damaging 0.97
R1532:Spta1 UTSW 1 174247353 missense probably damaging 0.99
R1551:Spta1 UTSW 1 174240166 missense possibly damaging 0.94
R1555:Spta1 UTSW 1 174178749 missense probably damaging 0.99
R1566:Spta1 UTSW 1 174184706 missense probably benign 0.00
R1586:Spta1 UTSW 1 174213495 missense probably benign 0.00
R1676:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R1711:Spta1 UTSW 1 174241042 missense probably damaging 1.00
R1795:Spta1 UTSW 1 174245730 missense probably damaging 1.00
R1823:Spta1 UTSW 1 174246549 missense probably benign 0.05
R1842:Spta1 UTSW 1 174195947 missense probably benign 0.00
R1867:Spta1 UTSW 1 174219839 missense probably benign 0.33
R1970:Spta1 UTSW 1 174240367 missense possibly damaging 0.88
R2042:Spta1 UTSW 1 174211647 missense probably benign 0.20
R2095:Spta1 UTSW 1 174244198 missense possibly damaging 0.75
R2125:Spta1 UTSW 1 174208344 missense possibly damaging 0.80
R2145:Spta1 UTSW 1 174212614 missense probably benign 0.00
R2158:Spta1 UTSW 1 174229258 missense probably benign 0.41
R2187:Spta1 UTSW 1 174192966 missense probably damaging 1.00
R2250:Spta1 UTSW 1 174244114 missense probably damaging 1.00
R2258:Spta1 UTSW 1 174174341 missense possibly damaging 0.76
R2319:Spta1 UTSW 1 174178656 critical splice acceptor site probably null
R3782:Spta1 UTSW 1 174208314 missense probably damaging 1.00
R4058:Spta1 UTSW 1 174241137 missense probably damaging 1.00
R4080:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4081:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4082:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4108:Spta1 UTSW 1 174174556 missense probably benign 0.01
R4115:Spta1 UTSW 1 174240357 missense probably damaging 1.00
R4303:Spta1 UTSW 1 174179852 missense probably damaging 1.00
R4419:Spta1 UTSW 1 174247424 nonsense probably null
R4525:Spta1 UTSW 1 174207110 missense probably null 1.00
R4614:Spta1 UTSW 1 174192977 missense probably damaging 1.00
R4673:Spta1 UTSW 1 174191062 splice site probably null
R4782:Spta1 UTSW 1 174230666 missense probably benign 0.01
R4825:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R4829:Spta1 UTSW 1 174237927 missense probably benign 0.01
R4873:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4875:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4898:Spta1 UTSW 1 174237834 missense possibly damaging 0.94
R4910:Spta1 UTSW 1 174217863 splice site probably null
R4911:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R4928:Spta1 UTSW 1 174191056 missense probably benign 0.15
R4959:Spta1 UTSW 1 174246608 missense probably damaging 0.97
R5009:Spta1 UTSW 1 174240223 missense possibly damaging 0.62
R5149:Spta1 UTSW 1 174247434 missense probably damaging 0.99
R5293:Spta1 UTSW 1 174195985 missense probably damaging 0.99
R5421:Spta1 UTSW 1 174215529 missense probably damaging 0.99
R5457:Spta1 UTSW 1 174217193 missense probably damaging 1.00
R5590:Spta1 UTSW 1 174175770 missense possibly damaging 0.73
R5606:Spta1 UTSW 1 174219902 missense probably damaging 1.00
R5736:Spta1 UTSW 1 174214255 critical splice donor site probably null
R5834:Spta1 UTSW 1 174184797 intron probably null
R5845:Spta1 UTSW 1 174241096 missense probably damaging 0.97
R5987:Spta1 UTSW 1 174223328 missense probably damaging 1.00
R6102:Spta1 UTSW 1 174224520 missense probably benign 0.01
R6221:Spta1 UTSW 1 174181776 missense probably damaging 1.00
R6276:Spta1 UTSW 1 174218512 missense probably damaging 1.00
R6317:Spta1 UTSW 1 174241087 missense probably damaging 1.00
R6329:Spta1 UTSW 1 174214177 missense possibly damaging 0.60
R6352:Spta1 UTSW 1 174211646 missense possibly damaging 0.94
R6374:Spta1 UTSW 1 174214168 missense probably damaging 1.00
R6376:Spta1 UTSW 1 174203322 missense probably benign
R6387:Spta1 UTSW 1 174231333 missense probably benign 0.01
R6451:Spta1 UTSW 1 174217201 missense probably damaging 0.97
R6480:Spta1 UTSW 1 174187148 intron probably null
R6533:Spta1 UTSW 1 174244147 missense probably damaging 1.00
R6585:Spta1 UTSW 1 174178685 missense probably damaging 1.00
R6695:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R6945:Spta1 UTSW 1 174209325 missense possibly damaging 0.89
R7020:Spta1 UTSW 1 174209352 missense probably damaging 1.00
R7086:Spta1 UTSW 1 174199484 missense probably damaging 0.98
R7087:Spta1 UTSW 1 174174510 missense probably benign
R7151:Spta1 UTSW 1 174197751 missense probably damaging 1.00
R7193:Spta1 UTSW 1 174184612 missense probably damaging 1.00
R7199:Spta1 UTSW 1 174223271 missense possibly damaging 0.61
R7219:Spta1 UTSW 1 174222637 missense probably damaging 0.96
T0722:Spta1 UTSW 1 174191066 splice site probably benign
X0028:Spta1 UTSW 1 174224450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTCACCCTGATACTGAACACTC -3'
(R):5'- CCAGTTGCTCCTAGCTCCAAGAAAG -3'

Sequencing Primer
(F):5'- CTTCTCTGGATGGTGAGGTGATA -3'
(R):5'- CCAAGGTGCTGAGTTACATGC -3'
Posted On2013-05-09