Incidental Mutation 'R4329:Cntnap5b'
ID324501
Institutional Source Beutler Lab
Gene Symbol Cntnap5b
Ensembl Gene ENSMUSG00000067028
Gene Namecontactin associated protein-like 5B
SynonymsCaspr5-2, C230078M14Rik
MMRRC Submission 041663-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R4329 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location99772765-100485942 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100072163 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 215 (D215E)
Ref Sequence ENSEMBL: ENSMUSP00000083944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086738]
Predicted Effect probably damaging
Transcript: ENSMUST00000086738
AA Change: D215E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083944
Gene: ENSMUSG00000067028
AA Change: D215E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 39 174 2.76e-16 SMART
LamG 201 338 2.84e-27 SMART
LamG 387 521 9.22e-27 SMART
EGF 549 583 1.14e0 SMART
Blast:FBG 586 758 3e-66 BLAST
LamG 798 925 2.12e-26 SMART
EGF 946 982 1.51e0 SMART
LamG 1023 1159 2.14e-13 SMART
transmembrane domain 1227 1249 N/A INTRINSIC
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 96% (68/71)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,421,226 probably benign Het
2900026A02Rik C A 5: 113,095,589 probably null Het
9930021J03Rik G T 19: 29,743,561 T688K probably benign Het
Adamts15 T C 9: 30,904,518 S681G probably benign Het
Ampd2 C A 3: 108,077,787 probably benign Het
Ang2 A T 14: 51,195,868 I19N possibly damaging Het
Cacna1s A C 1: 136,119,033 D1819A probably benign Het
Cand2 C A 6: 115,799,988 H1112Q possibly damaging Het
Catsperd T A 17: 56,654,517 I413K possibly damaging Het
Ccdc142 T A 6: 83,107,016 probably benign Het
Cd55 A T 1: 130,452,483 C253S probably damaging Het
Celsr3 C T 9: 108,846,049 R2847C probably benign Het
Cep290 C T 10: 100,537,668 S1270L probably damaging Het
Chka T C 19: 3,875,803 probably benign Het
Col13a1 T C 10: 61,863,979 T476A unknown Het
Cspg4 T C 9: 56,892,465 F1539L probably damaging Het
Cwf19l2 A T 9: 3,458,878 I776F probably damaging Het
Dchs1 A T 7: 105,753,759 I3192N probably damaging Het
Dnah7c T A 1: 46,649,281 D1870E probably benign Het
Drc1 A T 5: 30,355,658 I359L probably benign Het
Esp1 A G 17: 40,728,877 M18V probably benign Het
Exoc1 T A 5: 76,567,975 F789L probably damaging Het
Fbxw22 T A 9: 109,384,043 T279S probably damaging Het
Frem1 G A 4: 82,986,537 A880V probably benign Het
Gm29514 A G 1: 146,420,691 noncoding transcript Het
Grm7 T C 6: 110,914,364 L186P probably damaging Het
Ipo8 A T 6: 148,800,164 probably benign Het
Klk4 A G 7: 43,884,406 D202G probably damaging Het
March6 C T 15: 31,498,741 E137K probably benign Het
Mpp3 T C 11: 102,023,511 probably benign Het
Mroh2b T A 15: 4,931,379 Y808N probably damaging Het
Myom1 C T 17: 71,036,353 L182F probably damaging Het
Nova1 A T 12: 46,720,832 I102N unknown Het
Olfr854 T A 9: 19,567,022 M121L possibly damaging Het
Pak3 T C X: 143,733,209 probably null Het
Palm G A 10: 79,807,686 G83S probably benign Het
Patl2 C T 2: 122,127,537 S80N probably benign Het
Pcdhb9 A T 18: 37,401,822 S290C probably benign Het
Pcdhb9 G T 18: 37,401,823 S290I probably benign Het
Pdgfrb A T 18: 61,071,720 I551F possibly damaging Het
Pkmyt1 T A 17: 23,732,735 Y88N probably damaging Het
Pnkp T C 7: 44,858,594 S114P probably benign Het
Rdm1 T A 11: 101,630,908 V92E probably damaging Het
Sema4d T C 13: 51,703,304 R631G probably benign Het
Sin3a T C 9: 57,095,358 L178P probably damaging Het
Skint9 A C 4: 112,391,865 L122R probably damaging Het
Slc16a13 T C 11: 70,217,897 N369S probably benign Het
Strada A G 11: 106,187,173 probably benign Het
Tnxb C A 17: 34,693,864 S1784Y probably damaging Het
Trpc2 T C 7: 102,087,520 V318A probably damaging Het
Ttc3 G A 16: 94,466,961 R1589H probably damaging Het
Ttyh1 A T 7: 4,130,581 D295V probably damaging Het
Unc5b A G 10: 60,783,190 Y58H probably damaging Het
Xylt1 G A 7: 117,656,461 G752D probably damaging Het
Yipf7 A T 5: 69,521,122 L55Q probably damaging Het
Zfp827 G A 8: 79,189,834 probably benign Het
Other mutations in Cntnap5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Cntnap5b APN 1 100050754 missense probably damaging 1.00
IGL00477:Cntnap5b APN 1 100213743 missense probably damaging 0.97
IGL00505:Cntnap5b APN 1 100379161 missense possibly damaging 0.81
IGL00596:Cntnap5b APN 1 100379161 missense possibly damaging 0.81
IGL00846:Cntnap5b APN 1 100164223 missense probably damaging 1.00
IGL00895:Cntnap5b APN 1 100383585 missense probably damaging 0.98
IGL00948:Cntnap5b APN 1 100141357 missense probably benign 0.00
IGL01073:Cntnap5b APN 1 100076030 missense probably benign 0.08
IGL01523:Cntnap5b APN 1 100431779 missense probably benign 0.02
IGL01779:Cntnap5b APN 1 99967339 missense probably damaging 1.00
IGL02253:Cntnap5b APN 1 100164211 missense possibly damaging 0.75
IGL02628:Cntnap5b APN 1 100072069 missense probably damaging 0.97
R0166:Cntnap5b UTSW 1 100274361 missense probably benign 0.41
R0211:Cntnap5b UTSW 1 100478374 missense possibly damaging 0.82
R0281:Cntnap5b UTSW 1 100072153 missense probably benign 0.22
R0363:Cntnap5b UTSW 1 100274468 missense probably benign 0.01
R0514:Cntnap5b UTSW 1 99772786 missense probably benign
R0645:Cntnap5b UTSW 1 100072042 splice site probably benign
R0848:Cntnap5b UTSW 1 100255163 missense probably benign 0.22
R1006:Cntnap5b UTSW 1 100383617 missense probably benign 0.00
R1349:Cntnap5b UTSW 1 100164088 missense probably benign 0.09
R1372:Cntnap5b UTSW 1 100164088 missense probably benign 0.09
R1474:Cntnap5b UTSW 1 100072089 missense probably benign 0.25
R1681:Cntnap5b UTSW 1 100076107 missense probably damaging 0.98
R1727:Cntnap5b UTSW 1 100213744 missense possibly damaging 0.91
R1760:Cntnap5b UTSW 1 99772810 missense probably benign 0.05
R1777:Cntnap5b UTSW 1 100370078 missense probably benign 0.10
R1939:Cntnap5b UTSW 1 99967348 missense probably benign
R1988:Cntnap5b UTSW 1 100072140 missense possibly damaging 0.92
R2069:Cntnap5b UTSW 1 100358725 missense probably benign 0.04
R2113:Cntnap5b UTSW 1 100274415 missense probably benign
R2148:Cntnap5b UTSW 1 100383474 missense probably benign 0.01
R2158:Cntnap5b UTSW 1 100390572 missense probably damaging 1.00
R2223:Cntnap5b UTSW 1 100213687 missense probably damaging 1.00
R2350:Cntnap5b UTSW 1 100379126 missense probably damaging 1.00
R3840:Cntnap5b UTSW 1 100383477 missense possibly damaging 0.50
R4609:Cntnap5b UTSW 1 99772847 critical splice donor site probably null
R4799:Cntnap5b UTSW 1 100358725 missense probably benign 0.04
R5129:Cntnap5b UTSW 1 100379090 missense probably damaging 1.00
R5323:Cntnap5b UTSW 1 100383550 nonsense probably null
R5434:Cntnap5b UTSW 1 100072201 missense probably benign 0.02
R5579:Cntnap5b UTSW 1 100383395 nonsense probably null
R5579:Cntnap5b UTSW 1 100383399 missense probably benign 0.27
R5630:Cntnap5b UTSW 1 100072069 missense probably damaging 0.99
R5644:Cntnap5b UTSW 1 100383601 missense probably benign 0.00
R5761:Cntnap5b UTSW 1 100446894 missense probably damaging 1.00
R6042:Cntnap5b UTSW 1 100390592 missense probably benign
R6147:Cntnap5b UTSW 1 100050781 missense probably damaging 1.00
R6190:Cntnap5b UTSW 1 100379075 missense possibly damaging 0.80
R6248:Cntnap5b UTSW 1 100072102 missense probably benign 0.30
R6286:Cntnap5b UTSW 1 100255073 missense possibly damaging 0.82
R6306:Cntnap5b UTSW 1 100164146 missense probably damaging 1.00
R6336:Cntnap5b UTSW 1 100358669 missense probably benign 0.00
R6360:Cntnap5b UTSW 1 100431736 nonsense probably null
R6722:Cntnap5b UTSW 1 100478486 missense probably damaging 0.98
R6750:Cntnap5b UTSW 1 100274499 missense probably damaging 1.00
R6806:Cntnap5b UTSW 1 99940649 missense probably damaging 1.00
R6933:Cntnap5b UTSW 1 100383450 missense probably benign 0.01
R6957:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6958:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6959:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6961:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6962:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R7088:Cntnap5b UTSW 1 100160077 missense probably damaging 0.99
R7146:Cntnap5b UTSW 1 100050794 splice site probably null
R7165:Cntnap5b UTSW 1 100076162 missense possibly damaging 0.94
R7190:Cntnap5b UTSW 1 100431849 splice site probably null
R7376:Cntnap5b UTSW 1 99967269 missense possibly damaging 0.92
R7385:Cntnap5b UTSW 1 100379090 missense probably damaging 1.00
X0020:Cntnap5b UTSW 1 100431848 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTGTGAATTGAGCAGCATC -3'
(R):5'- AGCTGGTGAATTGTGGCTTAAC -3'

Sequencing Primer
(F):5'- CTGTGAATTGAGCAGCATCAAAGATG -3'
(R):5'- GGATATGTCATTTGATGCAGACTC -3'
Posted On2015-06-24