Incidental Mutation 'R4330:Vmn1r78'
ID324564
Institutional Source Beutler Lab
Gene Symbol Vmn1r78
Ensembl Gene ENSMUSG00000061602
Gene Namevomeronasal 1 receptor 78
SynonymsV1rg7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4330 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location12150257-12159959 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 12152459 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078039] [ENSMUST00000228244] [ENSMUST00000228664]
Predicted Effect probably null
Transcript: ENSMUST00000078039
SMART Domains Protein: ENSMUSP00000077186
Gene: ENSMUSG00000061602

DomainStartEndE-ValueType
Pfam:TAS2R 3 304 5.7e-8 PFAM
Pfam:V1R 12 301 1.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209489
Predicted Effect probably benign
Transcript: ENSMUST00000228244
Predicted Effect probably benign
Transcript: ENSMUST00000228664
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cdh10 G A 15: 18,999,959 V497I probably damaging Het
Chd4 T C 6: 125,101,602 V229A probably benign Het
Cnr2 T A 4: 135,916,926 I105N possibly damaging Het
Dnaic1 A G 4: 41,637,966 T701A probably damaging Het
Eri1 G A 8: 35,469,229 R313* probably null Het
Gm5346 T A 8: 43,626,250 K312N probably benign Het
Hrh3 T C 2: 180,099,872 probably benign Het
Hs3st5 T A 10: 36,832,730 V87D probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Mfsd4a A C 1: 132,053,553 M320R possibly damaging Het
Myocd A T 11: 65,223,764 H49Q probably benign Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Rabl2 T C 15: 89,586,934 D66G probably benign Het
Ramp1 C T 1: 91,223,345 T144I possibly damaging Het
Rhbdf2 T C 11: 116,601,956 K413R probably benign Het
Scpep1 G A 11: 88,935,903 Q236* probably null Het
Stil A G 4: 115,004,979 R40G probably damaging Het
Syt7 T C 19: 10,421,798 V86A probably damaging Het
Ubr2 A T 17: 46,967,278 L711Q probably null Het
Zfp280d C T 9: 72,295,979 T3I possibly damaging Het
Zscan25 T A 5: 145,290,551 F342I probably damaging Het
Other mutations in Vmn1r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Vmn1r78 APN 7 12153238 missense probably benign 0.10
IGL02019:Vmn1r78 APN 7 12152707 missense probably damaging 0.99
IGL02143:Vmn1r78 APN 7 12152480 missense probably benign
IGL02154:Vmn1r78 APN 7 12152545 missense probably benign 0.22
IGL02290:Vmn1r78 APN 7 12153155 missense probably damaging 1.00
IGL03012:Vmn1r78 APN 7 12153364 missense probably benign 0.32
IGL03256:Vmn1r78 APN 7 12152798 missense probably damaging 1.00
IGL03373:Vmn1r78 APN 7 12153343 missense possibly damaging 0.86
IGL03384:Vmn1r78 APN 7 12153209 missense possibly damaging 0.94
R0016:Vmn1r78 UTSW 7 12153352 missense probably benign 0.02
R1445:Vmn1r78 UTSW 7 12152581 missense possibly damaging 0.64
R1748:Vmn1r78 UTSW 7 12153323 missense probably damaging 1.00
R2017:Vmn1r78 UTSW 7 12153343 missense possibly damaging 0.86
R2032:Vmn1r78 UTSW 7 12153283 missense probably benign 0.00
R2198:Vmn1r78 UTSW 7 12152560 missense probably benign 0.06
R4564:Vmn1r78 UTSW 7 12152558 missense probably damaging 1.00
R4769:Vmn1r78 UTSW 7 12152798 missense probably damaging 1.00
R4801:Vmn1r78 UTSW 7 12152964 nonsense probably null
R4802:Vmn1r78 UTSW 7 12152964 nonsense probably null
R4860:Vmn1r78 UTSW 7 12152756 missense probably damaging 1.00
R4860:Vmn1r78 UTSW 7 12152756 missense probably damaging 1.00
R5648:Vmn1r78 UTSW 7 12152766 missense possibly damaging 0.92
R6561:Vmn1r78 UTSW 7 12152899 missense probably damaging 1.00
R6869:Vmn1r78 UTSW 7 12152749 missense probably benign 0.01
R6945:Vmn1r78 UTSW 7 12152905 missense probably benign 0.01
Z1088:Vmn1r78 UTSW 7 12152714 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTGTCTGTCCATTCATGATTAGG -3'
(R):5'- GCAGTTAGCAAAAGTCAAGTGC -3'

Sequencing Primer
(F):5'- AAAGACTGTCCTGGAACTGTCTCTG -3'
(R):5'- GTGCTTTATAATCACATCTTTGGGC -3'
Posted On2015-06-24