Incidental Mutation 'R4330:Nlk'
ID324571
Institutional Source Beutler Lab
Gene Symbol Nlk
Ensembl Gene ENSMUSG00000017376
Gene Namenemo like kinase
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4330 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78567168-78697373 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78590948 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 229 (I229T)
Ref Sequence ENSEMBL: ENSMUSP00000119345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000142739]
Predicted Effect possibly damaging
Transcript: ENSMUST00000142739
AA Change: I229T

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119345
Gene: ENSMUSG00000017376
AA Change: I229T

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 27 55 N/A INTRINSIC
low complexity region 97 119 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
S_TKc 138 427 3.36e-89 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation die either during late gestation or around 4-6 weeks, depending on background. Long survivors exhibit growth retardation, neurological abnormalities, and aberrant differentiation of bone marrow stromal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cdh10 G A 15: 18,999,959 V497I probably damaging Het
Chd4 T C 6: 125,101,602 V229A probably benign Het
Cnr2 T A 4: 135,916,926 I105N possibly damaging Het
Dnaic1 A G 4: 41,637,966 T701A probably damaging Het
Eri1 G A 8: 35,469,229 R313* probably null Het
Gm5346 T A 8: 43,626,250 K312N probably benign Het
Hrh3 T C 2: 180,099,872 probably benign Het
Hs3st5 T A 10: 36,832,730 V87D probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Mfsd4a A C 1: 132,053,553 M320R possibly damaging Het
Myocd A T 11: 65,223,764 H49Q probably benign Het
Rabl2 T C 15: 89,586,934 D66G probably benign Het
Ramp1 C T 1: 91,223,345 T144I possibly damaging Het
Rhbdf2 T C 11: 116,601,956 K413R probably benign Het
Scpep1 G A 11: 88,935,903 Q236* probably null Het
Stil A G 4: 115,004,979 R40G probably damaging Het
Syt7 T C 19: 10,421,798 V86A probably damaging Het
Ubr2 A T 17: 46,967,278 L711Q probably null Het
Vmn1r78 T A 7: 12,152,459 probably null Het
Zfp280d C T 9: 72,295,979 T3I possibly damaging Het
Zscan25 T A 5: 145,290,551 F342I probably damaging Het
Other mutations in Nlk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01772:Nlk APN 11 78589375 missense probably damaging 1.00
IGL02186:Nlk APN 11 78586936 missense probably damaging 1.00
IGL02336:Nlk APN 11 78586937 missense probably damaging 1.00
IGL02739:Nlk APN 11 78574851 missense probably benign 0.05
IGL02953:Nlk APN 11 78626701 missense probably benign 0.02
Verne UTSW 11 78587066 nonsense probably null
R0276:Nlk UTSW 11 78571475 missense probably benign 0.01
R0324:Nlk UTSW 11 78572431 missense possibly damaging 0.71
R0636:Nlk UTSW 11 78695844 missense probably benign 0.34
R0639:Nlk UTSW 11 78572277 missense possibly damaging 0.86
R1776:Nlk UTSW 11 78587027 missense probably benign 0.03
R1886:Nlk UTSW 11 78586928 missense probably damaging 1.00
R4331:Nlk UTSW 11 78590948 missense possibly damaging 0.79
R5974:Nlk UTSW 11 78590966 missense probably benign 0.39
R6532:Nlk UTSW 11 78696055 missense probably damaging 0.99
R6669:Nlk UTSW 11 78587066 nonsense probably null
R6873:Nlk UTSW 11 78590948 missense possibly damaging 0.79
R7165:Nlk UTSW 11 78590967 nonsense probably null
R7475:Nlk UTSW 11 78583399 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTAGCATGCTCAAGGATTTG -3'
(R):5'- TTGGCCTGTCTAGAAGCTAGC -3'

Sequencing Primer
(F):5'- AGTTTAATACCTAGCACTTCTAACCC -3'
(R):5'- GTCTAGAAGCTAGCTGTCTTCAAAC -3'
Posted On2015-06-24