Incidental Mutation 'R4357:Cnga1'
ID324597
Institutional Source Beutler Lab
Gene Symbol Cnga1
Ensembl Gene ENSMUSG00000067220
Gene Namecyclic nucleotide gated channel alpha 1
SynonymsCncg
MMRRC Submission 041109-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R4357 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location72603696-72644275 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72618252 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 42 (D42V)
Ref Sequence ENSEMBL: ENSMUSP00000143377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087213] [ENSMUST00000126799] [ENSMUST00000135701] [ENSMUST00000169997] [ENSMUST00000201463]
Predicted Effect probably damaging
Transcript: ENSMUST00000087213
AA Change: D42V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084464
Gene: ENSMUSG00000067220
AA Change: D42V

DomainStartEndE-ValueType
coiled coil region 111 150 N/A INTRINSIC
Pfam:Ion_trans 156 400 3e-33 PFAM
cNMP 471 595 3.31e-25 SMART
PDB:3SWF|C 615 684 6e-31 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000126799
AA Change: D42V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000135701
Predicted Effect probably damaging
Transcript: ENSMUST00000169997
AA Change: D42V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132329
Gene: ENSMUSG00000067220
AA Change: D42V

DomainStartEndE-ValueType
coiled coil region 111 150 N/A INTRINSIC
Pfam:Ion_trans 194 388 4.7e-19 PFAM
cNMP 471 595 3.31e-25 SMART
PDB:3SWF|C 615 684 6e-31 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000201463
AA Change: D42V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143881
Gene: ENSMUSG00000067220
AA Change: D42V

DomainStartEndE-ValueType
coiled coil region 111 150 N/A INTRINSIC
Pfam:Ion_trans 156 400 3e-33 PFAM
cNMP 471 595 3.31e-25 SMART
PDB:3SWF|C 615 684 6e-31 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in phototransduction. Along with another protein, the encoded protein forms a cGMP-gated cation channel in the plasma membrane, allowing depolarization of rod photoreceptors. This represents the last step in the phototransduction pathway. Defects in this gene are a cause of retinitis pigmentosa autosomal recessive (ARRP) disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,574,210 T420A probably benign Het
4930432K21Rik T C 8: 84,159,592 L59P probably benign Het
Adam20 A G 8: 40,795,047 T65A possibly damaging Het
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Ap4m1 A G 5: 138,173,049 E125G probably damaging Het
Atp13a2 C A 4: 141,001,904 D599E probably benign Het
Camkv G A 9: 107,947,946 G354E probably benign Het
Casp8ap2 T A 4: 32,646,150 M1741K probably benign Het
Chtf18 T C 17: 25,719,132 D119G probably benign Het
Cysltr2 T C 14: 73,029,644 I209V probably benign Het
Defa27 A T 8: 21,315,592 Q16L probably null Het
Dnaja3 T C 16: 4,699,867 I321T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif2ak3 T A 6: 70,884,875 I467N probably damaging Het
Eif5b T A 1: 38,050,258 V1105E probably damaging Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Gm10803 A G 2: 93,564,005 R41G unknown Het
Gm38392 A T 3: 88,247,434 I221N probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hsd17b6 G T 10: 127,993,768 probably null Het
Ids C A X: 70,346,344 G506C probably damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
Lats2 A G 14: 57,699,383 S550P probably damaging Het
Lmo7 A G 14: 101,887,655 R406G probably null Het
Lpcat2 C A 8: 92,873,106 P234Q probably benign Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Lrrfip2 A G 9: 111,199,687 E326G probably damaging Het
Megf8 T A 7: 25,355,749 I1969N probably benign Het
Mib1 A G 18: 10,751,844 N242S probably benign Het
Ngf A G 3: 102,520,205 E94G probably benign Het
Oas2 C T 5: 120,738,669 probably null Het
Odf2 A G 2: 29,892,244 T75A probably benign Het
Olfr1131 T A 2: 87,628,466 M1K probably null Het
Olfr1313 A G 2: 112,072,238 L115P probably damaging Het
Pi4ka T A 16: 17,367,439 I266F probably benign Het
Prps2 T A X: 167,363,549 K176* probably null Het
Psmd2 T G 16: 20,656,652 D393E probably benign Het
Rabep2 A G 7: 126,448,225 I753T probably damaging Het
Rara A C 11: 98,968,111 I129L probably damaging Het
Rasgrf2 C A 13: 91,890,677 D1017Y probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Sptlc1 A T 13: 53,374,032 I32K probably damaging Het
Srd5a3 T A 5: 76,147,700 F79Y probably damaging Het
Ssrp1 A T 2: 85,041,151 M306L probably benign Het
Sulf2 T C 2: 166,077,577 E817G probably benign Het
Tiam2 C A 17: 3,450,853 D922E probably damaging Het
Tle4 A G 19: 14,468,261 V207A probably benign Het
Ttll12 A T 15: 83,581,757 C413S probably damaging Het
Usp45 T A 4: 21,834,350 Y809* probably null Het
Vmn2r59 G A 7: 42,012,220 P724S probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Other mutations in Cnga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02332:Cnga1 APN 5 72604486 missense probably damaging 1.00
IGL02345:Cnga1 APN 5 72605272 missense probably benign 0.00
IGL02354:Cnga1 APN 5 72616718 splice site probably null
IGL02361:Cnga1 APN 5 72616718 splice site probably null
IGL03025:Cnga1 APN 5 72605413 missense probably benign
IGL03257:Cnga1 APN 5 72610862 missense probably damaging 1.00
IGL03046:Cnga1 UTSW 5 72604338 missense probably benign 0.01
R0238:Cnga1 UTSW 5 72605031 missense probably damaging 0.97
R0238:Cnga1 UTSW 5 72605031 missense probably damaging 0.97
R0352:Cnga1 UTSW 5 72604503 missense possibly damaging 0.95
R1292:Cnga1 UTSW 5 72604683 missense probably damaging 1.00
R1386:Cnga1 UTSW 5 72612183 nonsense probably null
R1903:Cnga1 UTSW 5 72616725 missense possibly damaging 0.94
R2096:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2097:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2101:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2276:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2279:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2507:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2508:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R3005:Cnga1 UTSW 5 72605107 missense probably damaging 1.00
R3779:Cnga1 UTSW 5 72604783 missense probably damaging 1.00
R4399:Cnga1 UTSW 5 72604381 missense probably damaging 0.98
R4615:Cnga1 UTSW 5 72604774 missense probably damaging 1.00
R4946:Cnga1 UTSW 5 72604764 missense probably damaging 1.00
R5229:Cnga1 UTSW 5 72609500 missense probably damaging 1.00
R5474:Cnga1 UTSW 5 72605193 missense probably damaging 1.00
R5566:Cnga1 UTSW 5 72618250 missense probably damaging 0.98
R5754:Cnga1 UTSW 5 72605272 missense probably benign 0.00
R5899:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R5906:Cnga1 UTSW 5 72610858 missense probably benign 0.19
R5954:Cnga1 UTSW 5 72604878 missense probably damaging 0.99
R5997:Cnga1 UTSW 5 72604575 missense probably damaging 0.98
R6087:Cnga1 UTSW 5 72610812 missense probably damaging 1.00
R6365:Cnga1 UTSW 5 72604945 missense probably benign 0.00
R6391:Cnga1 UTSW 5 72612359 critical splice donor site probably null
R6525:Cnga1 UTSW 5 72618231 missense probably damaging 1.00
R7046:Cnga1 UTSW 5 72629353 intron probably benign
R7229:Cnga1 UTSW 5 72618249 missense probably benign
R7299:Cnga1 UTSW 5 72605432 missense probably benign 0.20
R7367:Cnga1 UTSW 5 72605358 missense possibly damaging 0.75
R7425:Cnga1 UTSW 5 72609525 missense probably benign 0.12
R7449:Cnga1 UTSW 5 72605304 missense probably benign 0.29
R7538:Cnga1 UTSW 5 72612380 missense probably benign 0.24
X0062:Cnga1 UTSW 5 72604485 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATTTCGGTGGCAAGAGCAC -3'
(R):5'- TCGCTGGGCACACTCTGTATAG -3'

Sequencing Primer
(F):5'- AAGAGCACTGGCCACGC -3'
(R):5'- CTGGGCACACTCTGTATAGAATGC -3'
Posted On2015-06-24