Incidental Mutation 'R4357:Ap4m1'
ID324601
Institutional Source Beutler Lab
Gene Symbol Ap4m1
Ensembl Gene ENSMUSG00000019518
Gene Nameadaptor-related protein complex AP-4, mu 1
Synonyms
MMRRC Submission 041109-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R4357 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location138172002-138180429 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138173049 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 125 (E125G)
Ref Sequence ENSEMBL: ENSMUSP00000121338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000505] [ENSMUST00000019662] [ENSMUST00000139983] [ENSMUST00000143241] [ENSMUST00000147920] [ENSMUST00000148094] [ENSMUST00000148879] [ENSMUST00000151318] [ENSMUST00000153867] [ENSMUST00000155902]
Predicted Effect probably benign
Transcript: ENSMUST00000000505
SMART Domains Protein: ENSMUSP00000000505
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Blast:MCM 48 132 1e-41 BLAST
MCM 145 642 N/A SMART
AAA 373 526 2.9e-4 SMART
Blast:MCM 658 719 1e-32 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000019662
AA Change: E111G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019662
Gene: ENSMUSG00000019518
AA Change: E111G

DomainStartEndE-ValueType
SCOP:d1gw5m2 1 142 2e-49 SMART
Pfam:Adap_comp_sub 173 449 2.5e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134100
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139223
Predicted Effect probably benign
Transcript: ENSMUST00000139983
SMART Domains Protein: ENSMUSP00000121446
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Pfam:MCM_N 1 58 5.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142687
Predicted Effect probably benign
Transcript: ENSMUST00000143241
SMART Domains Protein: ENSMUSP00000123770
Gene: ENSMUSG00000019518

DomainStartEndE-ValueType
SCOP:d1gw5m2 1 86 2e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147920
Predicted Effect probably benign
Transcript: ENSMUST00000148094
SMART Domains Protein: ENSMUSP00000121344
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Blast:MCM 1 25 4e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148879
SMART Domains Protein: ENSMUSP00000116131
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Blast:MCM 48 132 6e-44 BLAST
MCM 145 389 1.77e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151318
AA Change: E125G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121338
Gene: ENSMUSG00000019518
AA Change: E125G

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 47 153 3.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153867
SMART Domains Protein: ENSMUSP00000121566
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Pfam:MCM_N 1 58 9.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155745
Predicted Effect probably benign
Transcript: ENSMUST00000155902
SMART Domains Protein: ENSMUSP00000120243
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Pfam:MCM_N 1 58 5.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157031
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the heterotetrameric AP-4 complex. The encoded protein belongs to the adaptor complexes medium subunits family. This AP-4 complex is involved in the recognition and sorting of cargo proteins with tyrosine-based motifs from the trans-golgi network to the endosomal-lysosomal system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,574,210 T420A probably benign Het
4930432K21Rik T C 8: 84,159,592 L59P probably benign Het
Adam20 A G 8: 40,795,047 T65A possibly damaging Het
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Atp13a2 C A 4: 141,001,904 D599E probably benign Het
Camkv G A 9: 107,947,946 G354E probably benign Het
Casp8ap2 T A 4: 32,646,150 M1741K probably benign Het
Chtf18 T C 17: 25,719,132 D119G probably benign Het
Cnga1 T A 5: 72,618,252 D42V probably damaging Het
Cysltr2 T C 14: 73,029,644 I209V probably benign Het
Defa27 A T 8: 21,315,592 Q16L probably null Het
Dnaja3 T C 16: 4,699,867 I321T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif2ak3 T A 6: 70,884,875 I467N probably damaging Het
Eif5b T A 1: 38,050,258 V1105E probably damaging Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Gm10803 A G 2: 93,564,005 R41G unknown Het
Gm38392 A T 3: 88,247,434 I221N probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hsd17b6 G T 10: 127,993,768 probably null Het
Ids C A X: 70,346,344 G506C probably damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
Lats2 A G 14: 57,699,383 S550P probably damaging Het
Lmo7 A G 14: 101,887,655 R406G probably null Het
Lpcat2 C A 8: 92,873,106 P234Q probably benign Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Lrrfip2 A G 9: 111,199,687 E326G probably damaging Het
Megf8 T A 7: 25,355,749 I1969N probably benign Het
Mib1 A G 18: 10,751,844 N242S probably benign Het
Ngf A G 3: 102,520,205 E94G probably benign Het
Oas2 C T 5: 120,738,669 probably null Het
Odf2 A G 2: 29,892,244 T75A probably benign Het
Olfr1131 T A 2: 87,628,466 M1K probably null Het
Olfr1313 A G 2: 112,072,238 L115P probably damaging Het
Pi4ka T A 16: 17,367,439 I266F probably benign Het
Prps2 T A X: 167,363,549 K176* probably null Het
Psmd2 T G 16: 20,656,652 D393E probably benign Het
Rabep2 A G 7: 126,448,225 I753T probably damaging Het
Rara A C 11: 98,968,111 I129L probably damaging Het
Rasgrf2 C A 13: 91,890,677 D1017Y probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Sptlc1 A T 13: 53,374,032 I32K probably damaging Het
Srd5a3 T A 5: 76,147,700 F79Y probably damaging Het
Ssrp1 A T 2: 85,041,151 M306L probably benign Het
Sulf2 T C 2: 166,077,577 E817G probably benign Het
Tiam2 C A 17: 3,450,853 D922E probably damaging Het
Tle4 A G 19: 14,468,261 V207A probably benign Het
Ttll12 A T 15: 83,581,757 C413S probably damaging Het
Usp45 T A 4: 21,834,350 Y809* probably null Het
Vmn2r59 G A 7: 42,012,220 P724S probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Other mutations in Ap4m1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01918:Ap4m1 APN 5 138172844 missense probably damaging 0.98
IGL03087:Ap4m1 APN 5 138174804 missense probably benign 0.01
R0227:Ap4m1 UTSW 5 138176276 unclassified probably benign
R0394:Ap4m1 UTSW 5 138172203 missense probably benign 0.32
R0639:Ap4m1 UTSW 5 138176239 missense probably benign 0.01
R4226:Ap4m1 UTSW 5 138172817 nonsense probably null
R5544:Ap4m1 UTSW 5 138178370 missense probably benign 0.15
R5585:Ap4m1 UTSW 5 138172240 missense probably damaging 1.00
R5631:Ap4m1 UTSW 5 138174789 makesense probably null
R5691:Ap4m1 UTSW 5 138172391 missense probably damaging 1.00
R6504:Ap4m1 UTSW 5 138178096 missense probably benign
R6636:Ap4m1 UTSW 5 138172175 unclassified probably benign
R6637:Ap4m1 UTSW 5 138172175 unclassified probably benign
X0062:Ap4m1 UTSW 5 138178311 unclassified probably null
Predicted Primers PCR Primer
(F):5'- GCCACAACCTTAGAAAACGTCT -3'
(R):5'- ATTGACCTAGTGCTTGAGTTATGGT -3'

Sequencing Primer
(F):5'- AGAAAACGTCTCTCCTTTCAGC -3'
(R):5'- ACCTAGTGCTTGAGTTATGGTGGATC -3'
Posted On2015-06-24