Incidental Mutation 'R4357:4921507P07Rik'
ID324602
Institutional Source Beutler Lab
Gene Symbol 4921507P07Rik
Ensembl Gene ENSMUSG00000029828
Gene NameRIKEN cDNA 4921507P07 gene
Synonyms
MMRRC Submission 041109-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R4357 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location50573302-50596632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50574210 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 420 (T420A)
Ref Sequence ENSEMBL: ENSMUSP00000031852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031852]
Predicted Effect probably benign
Transcript: ENSMUST00000031852
AA Change: T420A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031852
Gene: ENSMUSG00000029828
AA Change: T420A

DomainStartEndE-ValueType
Pfam:DUF4555 1 283 2e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184470
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik T C 8: 84,159,592 L59P probably benign Het
Adam20 A G 8: 40,795,047 T65A possibly damaging Het
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Ap4m1 A G 5: 138,173,049 E125G probably damaging Het
Atp13a2 C A 4: 141,001,904 D599E probably benign Het
Camkv G A 9: 107,947,946 G354E probably benign Het
Casp8ap2 T A 4: 32,646,150 M1741K probably benign Het
Chtf18 T C 17: 25,719,132 D119G probably benign Het
Cnga1 T A 5: 72,618,252 D42V probably damaging Het
Cysltr2 T C 14: 73,029,644 I209V probably benign Het
Defa27 A T 8: 21,315,592 Q16L probably null Het
Dnaja3 T C 16: 4,699,867 I321T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif2ak3 T A 6: 70,884,875 I467N probably damaging Het
Eif5b T A 1: 38,050,258 V1105E probably damaging Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Gm10803 A G 2: 93,564,005 R41G unknown Het
Gm38392 A T 3: 88,247,434 I221N probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hsd17b6 G T 10: 127,993,768 probably null Het
Ids C A X: 70,346,344 G506C probably damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
Lats2 A G 14: 57,699,383 S550P probably damaging Het
Lmo7 A G 14: 101,887,655 R406G probably null Het
Lpcat2 C A 8: 92,873,106 P234Q probably benign Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Lrrfip2 A G 9: 111,199,687 E326G probably damaging Het
Megf8 T A 7: 25,355,749 I1969N probably benign Het
Mib1 A G 18: 10,751,844 N242S probably benign Het
Ngf A G 3: 102,520,205 E94G probably benign Het
Oas2 C T 5: 120,738,669 probably null Het
Odf2 A G 2: 29,892,244 T75A probably benign Het
Olfr1131 T A 2: 87,628,466 M1K probably null Het
Olfr1313 A G 2: 112,072,238 L115P probably damaging Het
Pi4ka T A 16: 17,367,439 I266F probably benign Het
Prps2 T A X: 167,363,549 K176* probably null Het
Psmd2 T G 16: 20,656,652 D393E probably benign Het
Rabep2 A G 7: 126,448,225 I753T probably damaging Het
Rara A C 11: 98,968,111 I129L probably damaging Het
Rasgrf2 C A 13: 91,890,677 D1017Y probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Sptlc1 A T 13: 53,374,032 I32K probably damaging Het
Srd5a3 T A 5: 76,147,700 F79Y probably damaging Het
Ssrp1 A T 2: 85,041,151 M306L probably benign Het
Sulf2 T C 2: 166,077,577 E817G probably benign Het
Tiam2 C A 17: 3,450,853 D922E probably damaging Het
Tle4 A G 19: 14,468,261 V207A probably benign Het
Ttll12 A T 15: 83,581,757 C413S probably damaging Het
Usp45 T A 4: 21,834,350 Y809* probably null Het
Vmn2r59 G A 7: 42,012,220 P724S probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Other mutations in 4921507P07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:4921507P07Rik APN 6 50589184 critical splice acceptor site probably null
IGL01310:4921507P07Rik APN 6 50574195 missense probably benign
IGL01568:4921507P07Rik APN 6 50573698 utr 3 prime probably benign
IGL01794:4921507P07Rik APN 6 50577846 missense probably damaging 1.00
IGL02718:4921507P07Rik APN 6 50584387 missense probably damaging 1.00
IGL03146:4921507P07Rik APN 6 50573873 missense probably damaging 0.97
IGL03381:4921507P07Rik APN 6 50589136 missense probably damaging 1.00
R1173:4921507P07Rik UTSW 6 50589141 missense probably damaging 0.98
R1174:4921507P07Rik UTSW 6 50589141 missense probably damaging 0.98
R1175:4921507P07Rik UTSW 6 50589141 missense probably damaging 0.98
R1769:4921507P07Rik UTSW 6 50591821 splice site probably benign
R1883:4921507P07Rik UTSW 6 50574453 missense probably benign 0.01
R2056:4921507P07Rik UTSW 6 50573745 missense possibly damaging 0.71
R2437:4921507P07Rik UTSW 6 50583979 missense probably damaging 1.00
R2929:4921507P07Rik UTSW 6 50574305 missense probably benign 0.07
R4666:4921507P07Rik UTSW 6 50595828 missense possibly damaging 0.69
R4791:4921507P07Rik UTSW 6 50595837 missense probably damaging 1.00
R4827:4921507P07Rik UTSW 6 50595856 missense possibly damaging 0.76
R4976:4921507P07Rik UTSW 6 50589184 critical splice acceptor site probably null
R5453:4921507P07Rik UTSW 6 50595796 critical splice donor site probably null
R6689:4921507P07Rik UTSW 6 50589109 critical splice donor site probably null
R6897:4921507P07Rik UTSW 6 50589165 missense possibly damaging 0.82
X0021:4921507P07Rik UTSW 6 50573926 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCATATGGGTCACGGTAGG -3'
(R):5'- AGAACCAACGACCTCTGGAG -3'

Sequencing Primer
(F):5'- AGGCAGACTTAAGTGGTTCATAGTC -3'
(R):5'- CTCTGGAGGCTACAGTGCAAATAC -3'
Posted On2015-06-24