Incidental Mutation 'R4357:Rasgrf2'
ID324624
Institutional Source Beutler Lab
Gene Symbol Rasgrf2
Ensembl Gene ENSMUSG00000021708
Gene NameRAS protein-specific guanine nucleotide-releasing factor 2
SynonymsGrf2, 6330417G04Rik
MMRRC Submission 041109-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R4357 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location91880400-92131656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 91890677 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 1017 (D1017Y)
Ref Sequence ENSEMBL: ENSMUSP00000096930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099326]
Predicted Effect probably damaging
Transcript: ENSMUST00000099326
AA Change: D1017Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: D1017Y

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
RhoGEF 247 428 2.2e-51 SMART
RasGEFN 633 775 9.35e-15 SMART
RasGEFN 786 923 6.04e-9 SMART
RasGEF 949 1186 2.97e-112 SMART
Predicted Effect unknown
Transcript: ENSMUST00000151408
AA Change: D416Y
SMART Domains Protein: ENSMUSP00000116892
Gene: ENSMUSG00000021708
AA Change: D416Y

DomainStartEndE-ValueType
RasGEFN 33 175 9.35e-15 SMART
RasGEFN 186 323 6.04e-9 SMART
RasGEF 349 586 2.97e-112 SMART
Meta Mutation Damage Score 0.348 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,574,210 T420A probably benign Het
4930432K21Rik T C 8: 84,159,592 L59P probably benign Het
Adam20 A G 8: 40,795,047 T65A possibly damaging Het
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Ap4m1 A G 5: 138,173,049 E125G probably damaging Het
Atp13a2 C A 4: 141,001,904 D599E probably benign Het
Camkv G A 9: 107,947,946 G354E probably benign Het
Casp8ap2 T A 4: 32,646,150 M1741K probably benign Het
Chtf18 T C 17: 25,719,132 D119G probably benign Het
Cnga1 T A 5: 72,618,252 D42V probably damaging Het
Cysltr2 T C 14: 73,029,644 I209V probably benign Het
Defa27 A T 8: 21,315,592 Q16L probably null Het
Dnaja3 T C 16: 4,699,867 I321T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif2ak3 T A 6: 70,884,875 I467N probably damaging Het
Eif5b T A 1: 38,050,258 V1105E probably damaging Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Gm10803 A G 2: 93,564,005 R41G unknown Het
Gm38392 A T 3: 88,247,434 I221N probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hsd17b6 G T 10: 127,993,768 probably null Het
Ids C A X: 70,346,344 G506C probably damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
Lats2 A G 14: 57,699,383 S550P probably damaging Het
Lmo7 A G 14: 101,887,655 R406G probably null Het
Lpcat2 C A 8: 92,873,106 P234Q probably benign Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Lrrfip2 A G 9: 111,199,687 E326G probably damaging Het
Megf8 T A 7: 25,355,749 I1969N probably benign Het
Mib1 A G 18: 10,751,844 N242S probably benign Het
Ngf A G 3: 102,520,205 E94G probably benign Het
Oas2 C T 5: 120,738,669 probably null Het
Odf2 A G 2: 29,892,244 T75A probably benign Het
Olfr1131 T A 2: 87,628,466 M1K probably null Het
Olfr1313 A G 2: 112,072,238 L115P probably damaging Het
Pi4ka T A 16: 17,367,439 I266F probably benign Het
Prps2 T A X: 167,363,549 K176* probably null Het
Psmd2 T G 16: 20,656,652 D393E probably benign Het
Rabep2 A G 7: 126,448,225 I753T probably damaging Het
Rara A C 11: 98,968,111 I129L probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Sptlc1 A T 13: 53,374,032 I32K probably damaging Het
Srd5a3 T A 5: 76,147,700 F79Y probably damaging Het
Ssrp1 A T 2: 85,041,151 M306L probably benign Het
Sulf2 T C 2: 166,077,577 E817G probably benign Het
Tiam2 C A 17: 3,450,853 D922E probably damaging Het
Tle4 A G 19: 14,468,261 V207A probably benign Het
Ttll12 A T 15: 83,581,757 C413S probably damaging Het
Usp45 T A 4: 21,834,350 Y809* probably null Het
Vmn2r59 G A 7: 42,012,220 P724S probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Other mutations in Rasgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rasgrf2 APN 13 92022917 splice site probably benign
IGL01358:Rasgrf2 APN 13 91982630 missense probably benign 0.23
IGL01666:Rasgrf2 APN 13 92038210 missense probably damaging 1.00
IGL01930:Rasgrf2 APN 13 91982738 missense probably damaging 0.98
IGL02230:Rasgrf2 APN 13 91988026 missense probably damaging 1.00
IGL02630:Rasgrf2 APN 13 92131392 missense probably damaging 1.00
IGL02690:Rasgrf2 APN 13 92030765 missense probably damaging 1.00
IGL02943:Rasgrf2 APN 13 91983633 missense probably damaging 1.00
IGL03067:Rasgrf2 APN 13 92022905 missense probably damaging 0.97
IGL03342:Rasgrf2 APN 13 91987979 missense probably damaging 1.00
IGL03405:Rasgrf2 APN 13 91896051 missense probably damaging 1.00
R0620:Rasgrf2 UTSW 13 91919817 splice site probably benign
R0632:Rasgrf2 UTSW 13 91972274 missense probably benign 0.00
R0894:Rasgrf2 UTSW 13 91982771 missense probably damaging 1.00
R1354:Rasgrf2 UTSW 13 92028666 missense probably damaging 1.00
R1400:Rasgrf2 UTSW 13 91887689 missense probably damaging 1.00
R1437:Rasgrf2 UTSW 13 92030888 missense probably damaging 1.00
R1443:Rasgrf2 UTSW 13 91983676 missense probably damaging 1.00
R1522:Rasgrf2 UTSW 13 91896086 missense probably benign 0.00
R1553:Rasgrf2 UTSW 13 91890664 missense probably damaging 1.00
R1613:Rasgrf2 UTSW 13 91902621 missense probably damaging 1.00
R1883:Rasgrf2 UTSW 13 91969030 missense probably benign
R1934:Rasgrf2 UTSW 13 91983706 splice site probably null
R1990:Rasgrf2 UTSW 13 92035965 missense probably damaging 1.00
R2037:Rasgrf2 UTSW 13 91902629 missense probably damaging 0.99
R2043:Rasgrf2 UTSW 13 92030843 missense possibly damaging 0.91
R2135:Rasgrf2 UTSW 13 91972255 missense probably benign
R2193:Rasgrf2 UTSW 13 92023713 splice site probably null
R2406:Rasgrf2 UTSW 13 91972240 missense probably benign
R3055:Rasgrf2 UTSW 13 92029075 missense probably damaging 1.00
R3916:Rasgrf2 UTSW 13 92030788 missense probably damaging 1.00
R3954:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3955:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3956:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R4133:Rasgrf2 UTSW 13 91982654 missense possibly damaging 0.59
R4177:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4178:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4358:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4359:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4439:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4440:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4441:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4564:Rasgrf2 UTSW 13 91885654 nonsense probably null
R4576:Rasgrf2 UTSW 13 91896410 missense possibly damaging 0.58
R4590:Rasgrf2 UTSW 13 92038281 missense probably damaging 1.00
R4718:Rasgrf2 UTSW 13 91990830 critical splice donor site probably null
R4778:Rasgrf2 UTSW 13 91983661 missense probably damaging 0.99
R4790:Rasgrf2 UTSW 13 91988016 missense probably damaging 1.00
R4808:Rasgrf2 UTSW 13 92023682 missense probably damaging 1.00
R5151:Rasgrf2 UTSW 13 91896036 missense probably damaging 1.00
R5286:Rasgrf2 UTSW 13 92131433 missense possibly damaging 0.94
R5902:Rasgrf2 UTSW 13 91919892 missense probably damaging 1.00
R6180:Rasgrf2 UTSW 13 92029101 missense probably damaging 1.00
R6264:Rasgrf2 UTSW 13 92030785 missense probably damaging 1.00
R6369:Rasgrf2 UTSW 13 92131446 missense probably benign
R6428:Rasgrf2 UTSW 13 91987981 missense probably damaging 1.00
R6595:Rasgrf2 UTSW 13 92030853 missense probably damaging 1.00
R6619:Rasgrf2 UTSW 13 92028519 missense probably damaging 1.00
R6988:Rasgrf2 UTSW 13 91885635 missense probably benign 0.02
R7026:Rasgrf2 UTSW 13 91983613 missense probably damaging 1.00
R7038:Rasgrf2 UTSW 13 91982833 missense possibly damaging 0.95
R7045:Rasgrf2 UTSW 13 92022592 intron probably benign
R7056:Rasgrf2 UTSW 13 92030695 missense probably damaging 0.99
R7058:Rasgrf2 UTSW 13 91886402 missense probably damaging 0.99
R7256:Rasgrf2 UTSW 13 91884518 nonsense probably null
R7392:Rasgrf2 UTSW 13 91893737 missense
X0013:Rasgrf2 UTSW 13 92030855 missense probably damaging 1.00
X0026:Rasgrf2 UTSW 13 91902535 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCAGCAAGGTGTGTCATC -3'
(R):5'- ATCATTGTAGATTCCAGTCTCTCTG -3'

Sequencing Primer
(F):5'- CACACACTGTGGCTCACCTG -3'
(R):5'- TCTGGAAGAGAGTATCCAAAGATG -3'
Posted On2015-06-24