Incidental Mutation 'R4358:Scn4a'
ID324668
Institutional Source Beutler Lab
Gene Symbol Scn4a
Ensembl Gene ENSMUSG00000001027
Gene Namesodium channel, voltage-gated, type IV, alpha
SynonymsSkM1, mH2, Nav1.4
MMRRC Submission 041110-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4358 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106318592-106353288 bp(-) (GRCm38)
Type of Mutationintron (43 bp from exon)
DNA Base Change (assembly) G to A at 106348857 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021056]
Predicted Effect probably null
Transcript: ENSMUST00000021056
SMART Domains Protein: ENSMUSP00000021056
Gene: ENSMUSG00000001027

DomainStartEndE-ValueType
Pfam:Ion_trans 130 452 1.1e-80 PFAM
low complexity region 473 491 N/A INTRINSIC
Pfam:Ion_trans 571 805 4.2e-56 PFAM
Pfam:Na_trans_assoc 810 1020 3.2e-59 PFAM
Pfam:Ion_trans 1024 1299 1.4e-64 PFAM
Pfam:Ion_trans 1346 1603 6.1e-55 PFAM
Pfam:PKD_channel 1441 1598 1.4e-6 PFAM
IQ 1720 1742 2.5e-2 SMART
low complexity region 1815 1827 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174877
Meta Mutation Damage Score 0.6048 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele develop myotonia, increased myofiber damage, K+-sensitive paralysis and susceptibility to delayed weakness during recovery from fatigue. Homozygotes show perinatal lethality, low survival rate, unusual hind-limb clasping and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Birc6 T A 17: 74,619,668 probably null Het
Chil3 G A 3: 106,160,499 Q117* probably null Het
Daglb T C 5: 143,473,134 probably benign Het
Dnah11 G A 12: 118,125,843 R1163* probably null Het
Ftsj3 G A 11: 106,253,676 A134V probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Golga4 A G 9: 118,551,878 E507G probably benign Het
Ids C A X: 70,346,344 G506C probably damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
L3hypdh A T 12: 72,077,424 D247E probably damaging Het
Lama2 A T 10: 26,984,493 N2999K probably damaging Het
Lpcat2 C A 8: 92,873,106 P234Q probably benign Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Mcm9 A C 10: 53,537,653 C444G probably benign Het
Mecom G A 3: 29,979,785 Q246* probably null Het
Mib1 A G 18: 10,751,844 N242S probably benign Het
Olfr13 T A 6: 43,174,226 M80K probably damaging Het
Olfr943 G A 9: 39,184,568 C127Y probably damaging Het
P3h4 A G 11: 100,413,626 F263S probably damaging Het
Pcsk1 T C 13: 75,112,719 S354P possibly damaging Het
Pms2 T A 5: 143,925,926 F617Y probably damaging Het
Prps2 T A X: 167,363,549 K176* probably null Het
Psmd13 G T 7: 140,889,505 probably benign Het
Pygl G A 12: 70,195,690 S573L probably damaging Het
Rapgef3 A G 15: 97,748,648 V794A probably benign Het
Rasgrf2 C A 13: 91,890,677 D1017Y probably damaging Het
Rb1cc1 A G 1: 6,245,637 D555G probably damaging Het
Rptor G T 11: 119,671,345 E111D probably damaging Het
Sall4 T C 2: 168,755,480 E480G probably benign Het
Scn8a G A 15: 100,940,133 A94T probably benign Het
Slc26a6 T A 9: 108,861,783 C636S probably benign Het
Slc38a11 T C 2: 65,358,116 K103R probably benign Het
Sned1 T C 1: 93,274,659 L675P probably benign Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Tmem132d G A 5: 127,984,341 T399M possibly damaging Het
Zfp939 A G 7: 39,473,720 noncoding transcript Het
Zfp951 T C 5: 104,814,675 K342E probably damaging Het
Other mutations in Scn4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Scn4a APN 11 106319919 missense probably benign
IGL00846:Scn4a APN 11 106328118 missense probably benign 0.03
IGL01063:Scn4a APN 11 106330364 missense possibly damaging 0.91
IGL01450:Scn4a APN 11 106324661 missense probably damaging 0.99
IGL01922:Scn4a APN 11 106339152 critical splice donor site probably null
IGL02589:Scn4a APN 11 106328132 missense probably benign 0.08
IGL03171:Scn4a APN 11 106345592 missense probably benign 0.01
IGL03338:Scn4a APN 11 106320845 missense probably damaging 1.00
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0050:Scn4a UTSW 11 106320856 missense probably damaging 1.00
R0113:Scn4a UTSW 11 106345436 missense probably benign 0.00
R0193:Scn4a UTSW 11 106320538 nonsense probably null
R0410:Scn4a UTSW 11 106323949 missense probably damaging 1.00
R0512:Scn4a UTSW 11 106345677 missense probably damaging 1.00
R0532:Scn4a UTSW 11 106330400 missense probably benign 0.45
R1112:Scn4a UTSW 11 106320466 missense probably damaging 1.00
R1279:Scn4a UTSW 11 106335682 missense probably damaging 1.00
R1564:Scn4a UTSW 11 106345541 missense probably benign
R1712:Scn4a UTSW 11 106339354 missense probably damaging 1.00
R1712:Scn4a UTSW 11 106345547 missense probably benign 0.20
R1721:Scn4a UTSW 11 106320820 missense probably benign 0.31
R1900:Scn4a UTSW 11 106327533 missense probably damaging 1.00
R2057:Scn4a UTSW 11 106335724 missense probably damaging 0.97
R2209:Scn4a UTSW 11 106339225 missense probably damaging 1.00
R3416:Scn4a UTSW 11 106330413 missense probably benign 0.00
R3788:Scn4a UTSW 11 106344274 missense probably damaging 0.96
R3853:Scn4a UTSW 11 106320106 missense possibly damaging 0.94
R3861:Scn4a UTSW 11 106326124 splice site probably benign
R3912:Scn4a UTSW 11 106320716 missense probably damaging 1.00
R3983:Scn4a UTSW 11 106347818 missense probably damaging 1.00
R4036:Scn4a UTSW 11 106322057 missense possibly damaging 0.75
R4556:Scn4a UTSW 11 106320446 missense probably benign 0.32
R4677:Scn4a UTSW 11 106323962 missense probably damaging 1.00
R4863:Scn4a UTSW 11 106320002 missense probably damaging 1.00
R4924:Scn4a UTSW 11 106320088 missense possibly damaging 0.83
R5081:Scn4a UTSW 11 106348727 missense probably damaging 0.99
R5298:Scn4a UTSW 11 106339386 missense probably damaging 1.00
R5407:Scn4a UTSW 11 106320889 missense probably damaging 1.00
R5634:Scn4a UTSW 11 106330004 missense probably benign
R6381:Scn4a UTSW 11 106320311 missense probably damaging 1.00
R6468:Scn4a UTSW 11 106345676 missense probably damaging 1.00
R6489:Scn4a UTSW 11 106349180 missense probably benign 0.26
R6549:Scn4a UTSW 11 106343965 missense probably damaging 1.00
R6606:Scn4a UTSW 11 106328073 missense probably benign 0.39
R7037:Scn4a UTSW 11 106320900 missense probably damaging 0.98
R7064:Scn4a UTSW 11 106322157 missense possibly damaging 0.93
R7182:Scn4a UTSW 11 106330308 missense probably benign 0.21
R7194:Scn4a UTSW 11 106324236 missense probably benign 0.32
X0012:Scn4a UTSW 11 106330061 missense probably damaging 1.00
X0065:Scn4a UTSW 11 106322178 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCAGCATCACTCTGAACACTG -3'
(R):5'- GCCTCAGACCTTCATTGTGC -3'

Sequencing Primer
(F):5'- TGAACACTGAGTGCAGACCTG -3'
(R):5'- TTGTGCTCAACAAAGGAAAGGCC -3'
Posted On2015-06-24