Incidental Mutation 'R4275:Zfp518b'
ID324749
Institutional Source Beutler Lab
Gene Symbol Zfp518b
Ensembl Gene ENSMUSG00000046572
Gene Namezinc finger protein 518B
Synonyms
MMRRC Submission 041646-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R4275 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location38668484-38684826 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38671728 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 978 (V978A)
Ref Sequence ENSEMBL: ENSMUSP00000137381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057258] [ENSMUST00000178760] [ENSMUST00000179555] [ENSMUST00000180214]
Predicted Effect probably damaging
Transcript: ENSMUST00000057258
AA Change: V978A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061753
Gene: ENSMUSG00000046572
AA Change: V978A

DomainStartEndE-ValueType
ZnF_C2H2 138 160 2.32e-1 SMART
ZnF_C2H2 165 187 1.67e-2 SMART
ZnF_C2H2 193 216 1.16e-1 SMART
low complexity region 523 536 N/A INTRINSIC
low complexity region 636 645 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 1011 1023 N/A INTRINSIC
ZnF_C2H2 1044 1066 1.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178760
Predicted Effect probably damaging
Transcript: ENSMUST00000179555
AA Change: V978A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137381
Gene: ENSMUSG00000046572
AA Change: V978A

DomainStartEndE-ValueType
ZnF_C2H2 138 160 2.32e-1 SMART
ZnF_C2H2 165 187 1.67e-2 SMART
ZnF_C2H2 193 216 1.16e-1 SMART
low complexity region 523 536 N/A INTRINSIC
low complexity region 636 645 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 1011 1023 N/A INTRINSIC
ZnF_C2H2 1044 1066 1.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180214
SMART Domains Protein: ENSMUSP00000136948
Gene: ENSMUSG00000046572

DomainStartEndE-ValueType
ZnF_C2H2 138 160 2.32e-1 SMART
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1e T C 1: 154,493,325 Y322C probably damaging Het
Camsap2 A G 1: 136,270,876 V1462A probably benign Het
D3Ertd751e C A 3: 41,756,154 probably benign Het
Dhcr7 C T 7: 143,843,227 A152V probably damaging Het
Enpep A T 3: 129,332,278 N68K probably benign Het
Fam126b T C 1: 58,529,933 T440A probably benign Het
Fam131b G A 6: 42,321,307 L43F probably damaging Het
Fbxl5 T A 5: 43,762,772 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Igf2 T C 7: 142,655,786 M46V probably benign Het
Kntc1 T A 5: 123,767,779 Y367N probably damaging Het
Mapk8ip2 T C 15: 89,458,995 W647R probably damaging Het
Mettl21c C T 1: 44,010,556 V110I probably damaging Het
Mrgprh T C 17: 12,877,227 L118P probably damaging Het
Myadm A G 7: 3,297,102 T127A probably benign Het
Myh10 A T 11: 68,751,940 probably null Het
Nadk T A 4: 155,584,255 Y128N probably benign Het
Olfr1089 T C 2: 86,733,592 T7A probably damaging Het
Olfr996 T C 2: 85,579,863 V208A probably benign Het
Papolg A G 11: 23,868,378 I500T probably benign Het
Pkhd1 A T 1: 20,058,384 C4032S probably benign Het
Rnase1 A T 14: 51,145,870 L9Q probably damaging Het
Rspry1 G T 8: 94,649,761 V304L probably benign Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Scpep1 T C 11: 88,947,142 probably null Het
Serpina3m T A 12: 104,389,116 I14N probably damaging Het
Smg6 A C 11: 74,993,874 probably benign Het
Suz12 T C 11: 80,030,053 M593T probably damaging Het
Tmem139 A G 6: 42,264,105 E208G probably damaging Het
Tnxb A G 17: 34,698,231 Y2200C probably damaging Het
Usp19 T G 9: 108,498,694 V911G probably damaging Het
Vipr1 T C 9: 121,664,618 L245P probably damaging Het
Vmn2r105 T A 17: 20,228,640 I92F probably damaging Het
Zfp651 T A 9: 121,766,539 V576D probably damaging Het
Other mutations in Zfp518b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Zfp518b APN 5 38673766 missense possibly damaging 0.58
IGL01096:Zfp518b APN 5 38672788 missense probably benign 0.01
IGL02150:Zfp518b APN 5 38673343 missense probably damaging 1.00
IGL02150:Zfp518b APN 5 38673789 missense probably damaging 1.00
IGL02491:Zfp518b APN 5 38673780 missense possibly damaging 0.90
IGL02643:Zfp518b APN 5 38674155 missense probably damaging 1.00
IGL02710:Zfp518b APN 5 38672718 missense probably damaging 1.00
R0134:Zfp518b UTSW 5 38674659 start codon destroyed probably null 0.92
R0284:Zfp518b UTSW 5 38671740 missense probably damaging 1.00
R0308:Zfp518b UTSW 5 38672770 missense possibly damaging 0.64
R0421:Zfp518b UTSW 5 38674575 missense probably damaging 1.00
R0613:Zfp518b UTSW 5 38673603 missense probably damaging 1.00
R1604:Zfp518b UTSW 5 38673606 missense probably damaging 1.00
R1649:Zfp518b UTSW 5 38671881 missense probably damaging 1.00
R1845:Zfp518b UTSW 5 38671741 missense probably damaging 0.97
R1853:Zfp518b UTSW 5 38673407 missense probably benign 0.00
R2015:Zfp518b UTSW 5 38672002 missense probably benign 0.00
R2256:Zfp518b UTSW 5 38671636 missense possibly damaging 0.90
R3687:Zfp518b UTSW 5 38674112 missense probably damaging 1.00
R4600:Zfp518b UTSW 5 38673627 missense probably damaging 0.98
R4603:Zfp518b UTSW 5 38673627 missense probably damaging 0.98
R4739:Zfp518b UTSW 5 38674498 missense possibly damaging 0.89
R5519:Zfp518b UTSW 5 38674098 missense probably damaging 1.00
R6827:Zfp518b UTSW 5 38671539 missense probably damaging 1.00
R6982:Zfp518b UTSW 5 38672905 missense probably benign 0.00
R7263:Zfp518b UTSW 5 38672328 missense probably damaging 1.00
R7271:Zfp518b UTSW 5 38674564 missense probably benign 0.01
R7354:Zfp518b UTSW 5 38682779 start gained probably benign
Z1088:Zfp518b UTSW 5 38674293 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACTTAAAGACACACTGGGCG -3'
(R):5'- AATCCCGGCCGTTATTTCAAAG -3'

Sequencing Primer
(F):5'- GGTCGTCCGGCATCGAG -3'
(R):5'- GGCCGTTATTTCAAAGACCCC -3'
Posted On2015-06-24