Incidental Mutation 'R4360:Csn1s2a'
ID324849
Institutional Source Beutler Lab
Gene Symbol Csn1s2a
Ensembl Gene ENSMUSG00000061937
Gene Namecasein alpha s2-like A
SynonymsCsn1s2a, Csng
MMRRC Submission 041111-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4360 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location87774567-87788797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87781841 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 100 (V100L)
Ref Sequence ENSEMBL: ENSMUSP00000142901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076379] [ENSMUST00000196585] [ENSMUST00000196749] [ENSMUST00000200322]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076379
AA Change: V108L

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075716
Gene: ENSMUSG00000061937
AA Change: V108L

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
coiled coil region 58 86 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196585
AA Change: V93L

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143515
Gene: ENSMUSG00000061937
AA Change: V93L

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
low complexity region 51 80 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196749
AA Change: V107L

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143715
Gene: ENSMUSG00000061937
AA Change: V107L

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
coiled coil region 57 85 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200210
Predicted Effect possibly damaging
Transcript: ENSMUST00000200322
AA Change: V100L

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142901
Gene: ENSMUSG00000061937
AA Change: V100L

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
low complexity region 51 57 N/A INTRINSIC
low complexity region 72 87 N/A INTRINSIC
low complexity region 94 107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200350
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Adgra3 T C 5: 49,990,210 E496G possibly damaging Het
Atg14 C G 14: 47,568,370 E13Q probably benign Het
BC023105 G T 18: 60,442,001 noncoding transcript Het
Chd6 A G 2: 160,949,856 V2527A possibly damaging Het
Fah G A 7: 84,589,648 L330F probably damaging Het
Fmo2 T C 1: 162,882,014 N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,384,692 probably benign Het
Frmd4a A T 2: 4,601,241 H287L probably damaging Het
G2e3 T A 12: 51,363,414 probably benign Het
Gm1758 A T 16: 14,506,351 noncoding transcript Het
Gm7204 T C 16: 48,218,833 noncoding transcript Het
Gm829 T C 4: 45,718,819 noncoding transcript Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Islr T A 9: 58,157,604 N207Y probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Ncor2 A G 5: 125,028,972 S1546P probably damaging Het
Olfr539 T C 7: 140,667,817 F170L probably damaging Het
Olfr679 A C 7: 105,086,253 E179A probably damaging Het
Olfr830 G A 9: 18,875,717 C127Y probably damaging Het
Parp4 A G 14: 56,629,204 D1075G possibly damaging Het
Pkp2 A G 16: 16,268,682 I736V probably benign Het
Plekha8 T C 6: 54,622,186 I235T probably benign Het
Polq A G 16: 37,060,339 D955G probably benign Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Psmd1 A G 1: 86,133,737 K890E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scpep1 A G 11: 88,930,244 Y366H possibly damaging Het
Slc18a3 A G 14: 32,463,925 V167A probably benign Het
Sp8 A G 12: 118,848,665 D85G possibly damaging Het
Stard3nl G A 13: 19,370,484 S144L probably damaging Het
Stk4 A G 2: 164,088,959 E160G possibly damaging Het
Tbcb T C 7: 30,227,035 N119S probably benign Het
Tnc G T 4: 64,016,924 R592S probably benign Het
Trem3 T A 17: 48,249,773 S91T probably benign Het
Trpc6 A G 9: 8,610,266 E245G probably benign Het
Usp40 C T 1: 87,952,361 R1036H probably damaging Het
Usp47 G T 7: 112,054,932 G112C probably damaging Het
Wdr35 T C 12: 8,974,149 probably benign Het
Zc3h14 A G 12: 98,780,197 K555R probably benign Het
Zfp26 T C 9: 20,438,573 S232G probably benign Het
Zfp811 T C 17: 32,798,458 T202A probably benign Het
Other mutations in Csn1s2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Csn1s2a APN 5 87784580 missense possibly damaging 0.83
IGL01829:Csn1s2a APN 5 87786710 missense unknown
R0137:Csn1s2a UTSW 5 87778967 missense possibly damaging 0.46
R1503:Csn1s2a UTSW 5 87775799 missense possibly damaging 0.66
R1799:Csn1s2a UTSW 5 87778193 missense probably damaging 0.97
R1870:Csn1s2a UTSW 5 87778199 missense probably benign 0.27
R2400:Csn1s2a UTSW 5 87780155 critical splice donor site probably null
R2897:Csn1s2a UTSW 5 87781821 missense unknown
R4034:Csn1s2a UTSW 5 87781887 missense probably benign 0.27
R4377:Csn1s2a UTSW 5 87775821 missense probably benign
R4834:Csn1s2a UTSW 5 87781778 missense probably benign 0.27
R4965:Csn1s2a UTSW 5 87781838 missense possibly damaging 0.83
R6807:Csn1s2a UTSW 5 87781872 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTTTGTCAAACTGGCATAG -3'
(R):5'- ATCACACATGAATGGTTTTGCG -3'

Sequencing Primer
(F):5'- GACCTATGAAGAATAGTCACTAC -3'
(R):5'- CACATGAATGGTTTTGCGTGATTTAC -3'
Posted On2015-07-06