Incidental Mutation 'R4361:Gne'
ID324897
Institutional Source Beutler Lab
Gene Symbol Gne
Ensembl Gene ENSMUSG00000028479
Gene Nameglucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Synonyms
MMRRC Submission 041112-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4361 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location44034075-44084177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 44059947 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 149 (A149S)
Ref Sequence ENSEMBL: ENSMUSP00000134040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030201] [ENSMUST00000102936] [ENSMUST00000128439] [ENSMUST00000133709] [ENSMUST00000140724] [ENSMUST00000144985] [ENSMUST00000172533] [ENSMUST00000173234] [ENSMUST00000173274] [ENSMUST00000173383]
Predicted Effect probably benign
Transcript: ENSMUST00000030201
AA Change: A180S

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000030201
Gene: ENSMUSG00000028479
AA Change: A180S

DomainStartEndE-ValueType
Pfam:Epimerase_2 63 406 2.3e-69 PFAM
Pfam:ROK 440 747 1.4e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102936
AA Change: A149S

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000100000
Gene: ENSMUSG00000028479
AA Change: A149S

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 5.1e-75 PFAM
Pfam:ROK 411 596 6.5e-44 PFAM
low complexity region 685 707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128439
Predicted Effect probably benign
Transcript: ENSMUST00000133709
Predicted Effect probably benign
Transcript: ENSMUST00000140724
Predicted Effect probably benign
Transcript: ENSMUST00000144985
AA Change: A188S

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118443
Gene: ENSMUSG00000028479
AA Change: A188S

DomainStartEndE-ValueType
Pfam:Epimerase_2 71 213 1.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172514
Predicted Effect possibly damaging
Transcript: ENSMUST00000172533
AA Change: A149S

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134040
Gene: ENSMUSG00000028479
AA Change: A149S

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 1.6e-75 PFAM
PDB:3EO3|C 406 471 2e-33 PDB
SCOP:d1bu6o1 410 462 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173234
AA Change: A149S

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133521
Gene: ENSMUSG00000028479
AA Change: A149S

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 3.9e-75 PFAM
Pfam:ROK 453 522 1.6e-16 PFAM
low complexity region 611 633 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173274
AA Change: A149S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000134406
Gene: ENSMUSG00000028479
AA Change: A149S

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 292 2.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173383
SMART Domains Protein: ENSMUSP00000133440
Gene: ENSMUSG00000028479

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 133 3.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173976
Predicted Effect probably benign
Transcript: ENSMUST00000174522
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that initiates and regulates the biosynthesis of N-acetylneuraminic acid (NeuAc), a precursor of sialic acids. It is a rate-limiting enzyme in the sialic acid biosynthetic pathway. Sialic acid modification of cell surface molecules is crucial for their function in many biologic processes, including cell adhesion and signal transduction. Differential sialylation of cell surface molecules is also implicated in the tumorigenicity and metastatic behavior of malignant cells. Mutations in this gene are associated with sialuria, autosomal recessive inclusion body myopathy, and Nonaka myopathy. Alternative splicing of this gene results in transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes a block in sialic acid biosynthesis and early embryonic lethality. A knockout mouse expressing the human V572L mutation shows features similar to distal myopathy with rimmed vacuoles or hereditary inclusion body myopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,706 T538A probably damaging Het
1700027J19Rik A G 7: 4,151,780 V3A possibly damaging Het
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Aadac T A 3: 60,039,761 S293R probably benign Het
Cc2d1b G A 4: 108,624,750 probably benign Het
Ccdc157 C T 11: 4,146,550 A400T probably damaging Het
Cyp11b1 T A 15: 74,839,016 M232L possibly damaging Het
Dhrs2 G A 14: 55,241,189 D264N probably damaging Het
Dram2 T C 3: 106,566,215 probably benign Het
Dtx4 C A 19: 12,485,296 S373I probably benign Het
Eif4a1 G A 11: 69,667,464 probably benign Het
Eps15 T C 4: 109,380,031 probably null Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam135b T A 15: 71,490,827 Q235L probably damaging Het
Fgfr3 T C 5: 33,723,332 probably benign Het
Gabra4 C T 5: 71,633,545 probably null Het
Gins1 A G 2: 150,925,901 Y117C probably damaging Het
Gm12253 T A 11: 58,434,861 S53T probably benign Het
Gm884 CTTTT CTTTTT 11: 103,617,501 probably null Het
Gpc2 A T 5: 138,278,290 C191* probably null Het
Has2 G T 15: 56,681,948 A86E probably damaging Het
Ift80 A T 3: 68,963,649 S205T probably damaging Het
Irx5 G T 8: 92,358,397 A72S probably damaging Het
Kcnmb4 A T 10: 116,473,505 V6E probably benign Het
Kcnt1 A T 2: 25,878,032 Q51L probably benign Het
Klk1b11 A G 7: 43,995,954 probably null Het
Kmt2d T G 15: 98,863,670 M600L unknown Het
Lmtk2 T A 5: 144,147,664 S172R probably damaging Het
Lrrc46 G A 11: 97,034,670 probably benign Het
Mab21l2 C T 3: 86,547,190 V168M probably damaging Het
Magea3 C A X: 154,948,853 C218F probably benign Het
Magea3 A C X: 154,948,854 C218G possibly damaging Het
Man1a2 T C 3: 100,656,042 K96E probably benign Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Myf6 GGGGGCAG GG 10: 107,494,432 probably benign Het
Myom2 G A 8: 15,112,018 V984I possibly damaging Het
Nav1 G A 1: 135,607,437 probably benign Het
Nav3 T C 10: 109,852,986 K477E probably damaging Het
Nup98 T A 7: 102,145,714 H862L probably damaging Het
Pcnx2 G T 8: 125,768,298 S1608* probably null Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Ren1 A G 1: 133,359,041 I303V probably benign Het
Retreg3 T A 11: 101,103,887 probably null Het
Rnf6 C A 5: 146,211,279 V310F probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scrn2 C T 11: 97,032,238 A169V probably null Het
Slc4a10 T C 2: 62,243,385 S264P probably benign Het
Tex26 A T 5: 149,460,923 Q102L probably benign Het
Tex38 A G 4: 115,780,223 S128P probably benign Het
Trmt1l A G 1: 151,435,875 probably benign Het
Tyr G T 7: 87,429,076 H525Q probably benign Het
Veph1 T C 3: 66,159,316 N417S probably benign Het
Zfp597 A T 16: 3,865,900 S331T probably damaging Het
Other mutations in Gne
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Gne APN 4 44041860 intron probably null
IGL02028:Gne APN 4 44066852 missense probably damaging 1.00
IGL02106:Gne APN 4 44037306 missense probably damaging 1.00
IGL02216:Gne APN 4 44044761 missense probably benign 0.43
IGL03095:Gne APN 4 44055211 missense probably damaging 1.00
R0069:Gne UTSW 4 44060099 missense probably damaging 1.00
R0069:Gne UTSW 4 44060099 missense probably damaging 1.00
R0310:Gne UTSW 4 44060157 nonsense probably null
R0606:Gne UTSW 4 44042244 missense possibly damaging 0.55
R0658:Gne UTSW 4 44039033 missense possibly damaging 0.85
R1878:Gne UTSW 4 44040434 missense probably damaging 1.00
R2009:Gne UTSW 4 44055273 missense probably benign 0.00
R2338:Gne UTSW 4 44042196 missense probably damaging 0.99
R4043:Gne UTSW 4 44040383 missense possibly damaging 0.65
R4725:Gne UTSW 4 44066806 missense probably benign 0.31
R4869:Gne UTSW 4 44055204 critical splice donor site probably null
R5511:Gne UTSW 4 44041843 missense probably damaging 0.99
R5797:Gne UTSW 4 44060030 missense probably damaging 1.00
R6016:Gne UTSW 4 44039063 missense probably damaging 0.99
R6176:Gne UTSW 4 44053019 intron probably benign
R6461:Gne UTSW 4 44060078 missense probably damaging 1.00
R6804:Gne UTSW 4 44060210 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGCAAAACAACCATTAACCTG -3'
(R):5'- ATGGTAGAGTCGGTAGGCCTAG -3'

Sequencing Primer
(F):5'- GTTTGAATACATACCTAGCCACATC -3'
(R):5'- TAGGCCTAGCGCTCGTGAAG -3'
Posted On2015-07-06