Incidental Mutation 'R4362:2200002D01Rik'
List |< first << previous [record 100 of 33389] next >> last >|
ID324948
Institutional Source Beutler Lab
Gene Symbol 2200002D01Rik
Ensembl Gene ENSMUSG00000030587
Gene NameRIKEN cDNA 2200002D01 gene
SynonymsHAI-2 related small protein, H2RSP
MMRRC Submission 041671-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4362 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29246561-29248466 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 29248262 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032808] [ENSMUST00000032809] [ENSMUST00000108237] [ENSMUST00000108238] [ENSMUST00000138128] [ENSMUST00000142519]
Predicted Effect probably benign
Transcript: ENSMUST00000032808
SMART Domains Protein: ENSMUSP00000032808
Gene: ENSMUSG00000030587

DomainStartEndE-ValueType
Pfam:IMUP 1 114 1.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032809
SMART Domains Protein: ENSMUSP00000032809
Gene: ENSMUSG00000030588

DomainStartEndE-ValueType
low complexity region 45 65 N/A INTRINSIC
Pfam:YIF1 72 304 5.7e-86 PFAM
Pfam:Yip1 110 282 7.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108237
SMART Domains Protein: ENSMUSP00000103872
Gene: ENSMUSG00000030588

DomainStartEndE-ValueType
low complexity region 37 57 N/A INTRINSIC
Pfam:YIF1 64 176 3.9e-48 PFAM
Pfam:YIF1 169 244 2.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108238
SMART Domains Protein: ENSMUSP00000103873
Gene: ENSMUSG00000030588

DomainStartEndE-ValueType
low complexity region 42 62 N/A INTRINSIC
Pfam:YIF1 66 303 5.4e-107 PFAM
Pfam:Yip1 107 279 7.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138128
SMART Domains Protein: ENSMUSP00000117224
Gene: ENSMUSG00000030588

DomainStartEndE-ValueType
low complexity region 42 62 N/A INTRINSIC
low complexity region 100 110 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151339
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,270,745 S3179T unknown Het
Abcc6 A G 7: 45,998,832 probably benign Het
Adamts13 G A 2: 27,004,782 C1034Y probably damaging Het
Atp2b4 G T 1: 133,739,931 P125Q possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Bicc1 ATGTG ATG 10: 70,943,374 probably null Het
Cap1 G A 4: 122,862,987 P302S probably benign Het
Chodl G T 16: 78,944,658 probably null Het
Cplx2 A T 13: 54,378,817 T13S probably benign Het
Dennd5a G A 7: 109,896,343 R1194W probably damaging Het
Dsc2 T A 18: 20,050,157 D68V probably damaging Het
Dus4l A C 12: 31,648,828 I59R probably damaging Het
Edc3 C T 9: 57,713,546 P50L probably damaging Het
Ext1 G A 15: 53,107,591 probably benign Het
Fam105a C T 15: 27,664,343 probably null Het
Fam219a C T 4: 41,518,844 probably benign Het
Fbxl3 A T 14: 103,092,313 D106E probably damaging Het
Garem1 T C 18: 21,236,115 N50D possibly damaging Het
Gins1 G A 2: 150,909,762 R15H probably damaging Het
Glrx2 A G 1: 143,741,680 K44R possibly damaging Het
Icam1 A G 9: 21,026,312 D215G possibly damaging Het
Nedd9 A T 13: 41,317,953 I184N probably damaging Het
Olfr380 T C 11: 73,453,565 M216V probably benign Het
Olfr714 T C 7: 107,074,592 S255P probably damaging Het
Ppp1r32 T C 19: 10,475,021 Y375C probably damaging Het
Rhot2 A G 17: 25,842,091 C147R probably damaging Het
Setd4 T C 16: 93,583,686 probably null Het
Slc6a4 A G 11: 77,017,078 N356S probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tmem168 A C 6: 13,595,073 I381S probably benign Het
Tnfrsf11b T A 15: 54,256,159 T140S possibly damaging Het
Ttpa G T 4: 20,023,827 E130* probably null Het
Ubr5 A G 15: 38,078,403 V8A probably damaging Het
Vmn2r18 C T 5: 151,572,903 C450Y probably damaging Het
Vmn2r32 A T 7: 7,479,858 L39* probably null Het
Other mutations in 2200002D01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01724:2200002D01Rik APN 7 29247896 critical splice donor site probably null
IGL02532:2200002D01Rik APN 7 29248220 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GACGGAAGCCAGTTCTCATCTC -3'
(R):5'- GGAATTCCTGAGATGGGCAG -3'

Sequencing Primer
(F):5'- GCCAGTTCTCATCTCGGGCC -3'
(R):5'- AGGTCGTGCAGTCCCAC -3'
Posted On2015-07-06