Mutagenetix > Incidental Mutation

Incidental Mutation 'R4362:Fbxl3'

324960

Institutional Source

Beutler Lab

Gene Symbol

Fbxl3

Ensembl Gene

ENSMUSG00000022124

Gene Name

F-box and leucine-rich repeat protein 3

Synonyms

Fbxl3a, Play68, Ovtm, Fbl3a

MMRRC Submission

041671-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.188) question?

Stock #

R4362 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103317675-103337002 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 103329749 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 106 (D106E)

Ref Sequence

ENSEMBL: ENSMUSP00000117701 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022720] [ENSMUST00000123043] [ENSMUST00000132004] [ENSMUST00000144141] [ENSMUST00000145693]

AlphaFold

Q8C4V4

Predicted Effect

probably benign
Transcript: ENSMUST00000022720
AA Change: D154E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000022720
Gene: ENSMUSG00000022124
AA Change: D154E

Domain	Start	End	E-Value	Type
FBOX	39	79	5.92e-7	SMART
low complexity region	235	247	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000123043
AA Change: D106E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000117701
Gene: ENSMUSG00000022124
AA Change: D106E

Domain	Start	End	E-Value	Type
FBOX	39	79	2.46e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127113

Predicted Effect

probably benign
Transcript: ENSMUST00000132004
AA Change: D106E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000115843
Gene: ENSMUSG00000022124
AA Change: D106E

Domain	Start	End	E-Value	Type
FBOX	39	79	2.46e-4	SMART
low complexity region	187	199	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000144141
AA Change: D154E

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000120691
Gene: ENSMUSG00000022124
AA Change: D154E

Domain	Start	End	E-Value	Type
FBOX	39	79	5.92e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000145693
AA Change: D154E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000116044
Gene: ENSMUSG00000022124
AA Change: D154E

Domain	Start	End	E-Value	Type
FBOX	39	79	5.92e-7	SMART
low complexity region	235	247	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226952

Meta Mutation Damage Score

0.0654

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains several tandem leucine-rich repeats and is localized in the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Both heterozygous and homozygous mutant mice display a longer free running period than that of wild-type mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2200002D01Rik	C	T	7: 28,947,687 (GRCm39)		probably benign	Het
Abcc6	A	G	7: 45,648,256 (GRCm39)		probably benign	Het
Adamts13	G	A	2: 26,894,794 (GRCm39)	C1034Y	probably damaging	Het
Atp2b4	G	T	1: 133,667,669 (GRCm39)	P125Q	possibly damaging	Het
Atp8b1	C	T	18: 64,697,608 (GRCm39)	R412H	probably damaging	Het
Bicc1	ATGTG	ATG	10: 70,779,204 (GRCm39)		probably null	Het
Cap1	G	A	4: 122,756,780 (GRCm39)	P302S	probably benign	Het
Chodl	G	T	16: 78,741,546 (GRCm39)		probably null	Het
Cplane1	T	A	15: 8,300,229 (GRCm39)	S3179T	unknown	Het
Cplx2	A	T	13: 54,526,630 (GRCm39)	T13S	probably benign	Het
Dennd5a	G	A	7: 109,495,550 (GRCm39)	R1194W	probably damaging	Het
Dsc2	T	A	18: 20,183,214 (GRCm39)	D68V	probably damaging	Het
Dus4l	A	C	12: 31,698,827 (GRCm39)	I59R	probably damaging	Het
Edc3	C	T	9: 57,620,829 (GRCm39)	P50L	probably damaging	Het
Ext1	G	A	15: 52,970,987 (GRCm39)		probably benign	Het
Fam219a	C	T	4: 41,518,844 (GRCm39)		probably benign	Het
Garem1	T	C	18: 21,369,172 (GRCm39)	N50D	possibly damaging	Het
Gins1	G	A	2: 150,751,682 (GRCm39)	R15H	probably damaging	Het
Glrx2	A	G	1: 143,617,418 (GRCm39)	K44R	possibly damaging	Het
Icam1	A	G	9: 20,937,608 (GRCm39)	D215G	possibly damaging	Het
Nedd9	A	T	13: 41,471,429 (GRCm39)	I184N	probably damaging	Het
Or10a2	T	C	7: 106,673,799 (GRCm39)	S255P	probably damaging	Het
Or1e21	T	C	11: 73,344,391 (GRCm39)	M216V	probably benign	Het
Otulinl	C	T	15: 27,664,429 (GRCm39)		probably null	Het
Rhot2	A	G	17: 26,061,065 (GRCm39)	C147R	probably damaging	Het
Saxo4	T	C	19: 10,452,385 (GRCm39)	Y375C	probably damaging	Het
Setd4	T	C	16: 93,380,574 (GRCm39)		probably null	Het
Slc6a4	A	G	11: 76,907,904 (GRCm39)	N356S	probably damaging	Het
Tas2r136	C	A	6: 132,754,972 (GRCm39)	V52L	probably damaging	Het
Tmem168	A	C	6: 13,595,072 (GRCm39)	I381S	probably benign	Het
Tnfrsf11b	T	A	15: 54,119,555 (GRCm39)	T140S	possibly damaging	Het
Ttpa	G	T	4: 20,023,827 (GRCm39)	E130*	probably null	Het
Ubr5	A	G	15: 38,078,647 (GRCm39)	V8A	probably damaging	Het
Vmn2r18	C	T	5: 151,496,368 (GRCm39)	C450Y	probably damaging	Het
Vmn2r32	A	T	7: 7,482,857 (GRCm39)	L39*	probably null	Het

Other mutations in Fbxl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Fbxl3	APN	14	103,332,730 (GRCm39)	missense	probably damaging	1.00
IGL01981:Fbxl3	APN	14	103,332,900 (GRCm39)	missense	possibly damaging	0.79
IGL03208:Fbxl3	APN	14	103,320,376 (GRCm39)	nonsense	probably null
delargo	UTSW	14	103,326,854 (GRCm39)	missense	probably damaging	1.00
PIT4403001:Fbxl3	UTSW	14	103,332,900 (GRCm39)	missense	possibly damaging	0.79
R0282:Fbxl3	UTSW	14	103,332,661 (GRCm39)	missense	probably damaging	1.00
R0462:Fbxl3	UTSW	14	103,320,322 (GRCm39)	missense	probably damaging	1.00
R0710:Fbxl3	UTSW	14	103,326,751 (GRCm39)	missense	probably damaging	1.00
R1075:Fbxl3	UTSW	14	103,332,839 (GRCm39)	missense	probably benign	0.00
R2263:Fbxl3	UTSW	14	103,320,648 (GRCm39)	nonsense	probably null
R4239:Fbxl3	UTSW	14	103,326,854 (GRCm39)	missense	probably damaging	1.00
R4497:Fbxl3	UTSW	14	103,320,313 (GRCm39)	missense	probably damaging	1.00
R4585:Fbxl3	UTSW	14	103,320,526 (GRCm39)	missense	probably damaging	0.99
R4586:Fbxl3	UTSW	14	103,320,526 (GRCm39)	missense	probably damaging	0.99
R5347:Fbxl3	UTSW	14	103,320,730 (GRCm39)	missense	probably damaging	0.97
R5349:Fbxl3	UTSW	14	103,333,012 (GRCm39)	intron	probably benign
R5885:Fbxl3	UTSW	14	103,320,667 (GRCm39)	missense	probably benign	0.06
R6744:Fbxl3	UTSW	14	103,320,730 (GRCm39)	missense	probably damaging	0.99
R8314:Fbxl3	UTSW	14	103,326,876 (GRCm39)	missense	probably benign	0.04
R9015:Fbxl3	UTSW	14	103,329,790 (GRCm39)	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- CATTCCACGGAAGGACAAGG -3'
(R):5'- TTAGTCTTTCAGCACCAAACAC -3'

Sequencing Primer
(F):5'- TGGAGAACCTAAGCTTTGCTGACC -3'
(R):5'- TGAACACAATCTTGAAGATTAGACTG -3'

Posted On

2015-07-06