Incidental Mutation 'R0010:Nav3'
ID32497
Institutional Source Beutler Lab
Gene Symbol Nav3
Ensembl Gene ENSMUSG00000020181
Gene Nameneuron navigator 3
SynonymsPOMFIL1, 9630020C08Rik, 4732483H20Rik, unc53H3, steerin 3, Pomfil1p
MMRRC Submission 038305-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R0010 (G1)
Quality Score155
Status Validated (trace)
Chromosome10
Chromosomal Location109681259-110456204 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 109823226 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032719]
Predicted Effect probably benign
Transcript: ENSMUST00000032719
SMART Domains Protein: ENSMUSP00000032719
Gene: ENSMUSG00000020181

DomainStartEndE-ValueType
CH 79 182 4.41e-12 SMART
low complexity region 184 194 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 353 363 N/A INTRINSIC
low complexity region 427 439 N/A INTRINSIC
low complexity region 522 536 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 904 916 N/A INTRINSIC
low complexity region 1077 1095 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1207 1229 N/A INTRINSIC
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1274 1285 N/A INTRINSIC
low complexity region 1293 1312 N/A INTRINSIC
low complexity region 1327 1341 N/A INTRINSIC
low complexity region 1383 1397 N/A INTRINSIC
low complexity region 1462 1474 N/A INTRINSIC
low complexity region 1550 1563 N/A INTRINSIC
coiled coil region 1565 1656 N/A INTRINSIC
low complexity region 1675 1692 N/A INTRINSIC
low complexity region 1722 1733 N/A INTRINSIC
low complexity region 1756 1781 N/A INTRINSIC
low complexity region 1782 1795 N/A INTRINSIC
coiled coil region 1801 1842 N/A INTRINSIC
low complexity region 1848 1871 N/A INTRINSIC
AAA 2029 2184 4.94e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161582
SMART Domains Protein: ENSMUSP00000124591
Gene: ENSMUSG00000020181

DomainStartEndE-ValueType
low complexity region 84 95 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 354 372 N/A INTRINSIC
low complexity region 437 450 N/A INTRINSIC
low complexity region 484 506 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 551 562 N/A INTRINSIC
low complexity region 570 589 N/A INTRINSIC
low complexity region 604 618 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 739 751 N/A INTRINSIC
low complexity region 827 840 N/A INTRINSIC
coiled coil region 842 933 N/A INTRINSIC
low complexity region 952 969 N/A INTRINSIC
low complexity region 992 1003 N/A INTRINSIC
low complexity region 1026 1051 N/A INTRINSIC
low complexity region 1052 1065 N/A INTRINSIC
coiled coil region 1071 1112 N/A INTRINSIC
low complexity region 1118 1141 N/A INTRINSIC
AAA 1299 1454 4.94e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. Multiple alternatively spliced transcript variants for this gene have been described but only one has had its full-length nature determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,205,609 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Bbs7 T C 3: 36,607,717 probably null Het
BC037034 T C 5: 138,260,293 probably null Het
Cacna1h T C 17: 25,380,844 K1566E probably damaging Het
Ccdc73 C T 2: 104,980,987 probably benign Het
Cd74 A T 18: 60,803,896 probably benign Het
Cd74 A T 18: 60,809,071 H124L probably benign Het
Cdk5rap2 T C 4: 70,243,459 E270G probably benign Het
Ces2a G A 8: 104,741,396 D520N probably benign Het
Cldnd1 T A 16: 58,731,259 probably benign Het
Cox17 T A 16: 38,347,170 C24S possibly damaging Het
Cyp2b9 T A 7: 26,186,753 probably benign Het
Dennd4a T C 9: 64,896,715 L1112P probably benign Het
Dennd4c T C 4: 86,781,577 S222P probably damaging Het
Dhx37 T A 5: 125,431,616 Q85L probably benign Het
Egfem1 G T 3: 29,582,919 C192F probably damaging Het
Eif3f A T 7: 108,941,005 N336Y possibly damaging Het
Evc2 T A 5: 37,417,449 L1016Q probably damaging Het
Fam114a2 G T 11: 57,514,156 T40N probably damaging Het
Fam135b T C 15: 71,622,032 K16R probably damaging Het
Fcho1 A G 8: 71,709,999 Y725H probably damaging Het
Frem1 T C 4: 83,000,098 I536V probably benign Het
Ginm1 T C 10: 7,775,374 probably benign Het
Glrb A T 3: 80,860,315 probably benign Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gm10320 T C 13: 98,489,546 Y110C probably damaging Het
Gm20388 G A 8: 122,270,598 probably benign Het
Gm3985 A T 8: 32,942,456 noncoding transcript Het
Gm5422 A G 10: 31,249,754 noncoding transcript Het
Igkv6-29 A T 6: 70,138,770 probably benign Het
Inpp5d G A 1: 87,697,546 probably null Het
Itpr3 T G 17: 27,120,977 V2610G probably damaging Het
Kmt5c T A 7: 4,746,208 M88K probably benign Het
Lrp12 C T 15: 39,878,276 A367T probably damaging Het
Ltbp1 A G 17: 75,363,391 T1476A probably damaging Het
Mcoln2 C T 3: 146,183,561 T374M probably damaging Het
Milr1 T G 11: 106,767,003 *209G probably null Het
Mitf A G 6: 97,807,281 K33R probably benign Het
Mon2 A C 10: 123,032,694 S485A probably damaging Het
Mpdu1 C T 11: 69,658,841 G47R probably damaging Het
Ms4a4d A G 19: 11,554,826 N112S probably damaging Het
Mybpc3 G A 2: 91,134,833 W1082* probably null Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Naa15 A T 3: 51,436,213 probably null Het
Nek7 T A 1: 138,544,204 Q66L possibly damaging Het
Nktr G A 9: 121,741,166 probably benign Het
Nlgn1 G T 3: 25,435,842 probably benign Het
Npr1 T C 3: 90,454,832 E1002G probably damaging Het
Nup133 A T 8: 123,904,579 I1072N probably damaging Het
Oc90 C T 15: 65,876,548 C371Y probably damaging Het
Olfr835 A T 9: 19,035,322 L66F probably damaging Het
Olfr901 A T 9: 38,430,920 I213F possibly damaging Het
Olfr994 A T 2: 85,429,895 D311E probably benign Het
Pradc1 A T 6: 85,447,231 N44K probably damaging Het
Pradc1 T C 6: 85,447,620 D116G probably damaging Het
Ptprk G A 10: 28,585,969 C91Y probably damaging Het
Pus7 T C 5: 23,747,845 I491V probably benign Het
Rock1 T A 18: 10,084,380 D951V probably damaging Het
Scgb2b26 T A 7: 33,944,349 E55D probably damaging Het
Scn8a T C 15: 101,013,573 V958A probably damaging Het
Sec14l1 T C 11: 117,143,770 probably benign Het
Sec24c A G 14: 20,689,261 probably benign Het
Sema6b C T 17: 56,124,105 E853K probably benign Het
Sgk1 G A 10: 21,997,438 probably null Het
Shprh C T 10: 11,151,931 T94I probably benign Het
Slc16a3 T C 11: 120,956,705 S240P probably benign Het
Slc5a8 T C 10: 88,886,590 V95A probably benign Het
Smg1 A T 7: 118,171,859 probably benign Het
Spta1 G A 1: 174,217,943 V1556I probably benign Het
Svs1 A T 6: 48,988,906 H616L probably damaging Het
Trappc4 G A 9: 44,405,231 probably benign Het
Tubgcp6 A G 15: 89,103,183 S1188P probably benign Het
Txlna T G 4: 129,629,086 D487A probably benign Het
Ube2d2b T C 5: 107,830,636 F51S possibly damaging Het
Vmn2r6 G A 3: 64,559,545 Q178* probably null Het
Wdfy3 T C 5: 101,848,349 T3234A probably damaging Het
Ylpm1 C A 12: 85,029,026 Q384K probably damaging Het
Zbtb41 T G 1: 139,423,530 V127G probably damaging Het
Zfp605 T A 5: 110,127,534 C173S probably benign Het
Zfp608 A T 18: 54,895,214 probably benign Het
Zhx2 T C 15: 57,821,274 V13A possibly damaging Het
Other mutations in Nav3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Nav3 APN 10 109841733 missense probably damaging 0.99
IGL00425:Nav3 APN 10 109703507 missense probably benign 0.13
IGL00465:Nav3 APN 10 109852746 missense probably damaging 0.99
IGL00531:Nav3 APN 10 109703310 missense probably null 0.99
IGL00575:Nav3 APN 10 109764765 missense probably damaging 0.98
IGL00770:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00774:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00858:Nav3 APN 10 109742632 missense probably damaging 0.98
IGL00935:Nav3 APN 10 109705666 missense probably benign
IGL01638:Nav3 APN 10 109852863 missense probably damaging 1.00
IGL01662:Nav3 APN 10 109769258 missense possibly damaging 0.56
IGL01670:Nav3 APN 10 109714241 missense possibly damaging 0.92
IGL01885:Nav3 APN 10 109742660 nonsense probably null
IGL01979:Nav3 APN 10 109704929 missense probably benign 0.01
IGL02121:Nav3 APN 10 109759036 missense probably damaging 0.99
IGL02210:Nav3 APN 10 109766990 missense probably benign
IGL02523:Nav3 APN 10 109769296 missense probably damaging 1.00
IGL02573:Nav3 APN 10 109866974 missense probably benign 0.23
IGL02633:Nav3 APN 10 109692136 missense probably benign 0.09
IGL02810:Nav3 APN 10 109816274 missense probably damaging 1.00
IGL02964:Nav3 APN 10 109736953 missense probably damaging 0.99
IGL03015:Nav3 APN 10 109718297 missense probably damaging 0.98
IGL03288:Nav3 APN 10 109759017 missense probably damaging 1.00
IGL03310:Nav3 APN 10 109824572 critical splice donor site probably null
PIT4377001:Nav3 UTSW 10 109716605 missense probably damaging 0.99
R0043:Nav3 UTSW 10 109767518 missense possibly damaging 0.95
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0077:Nav3 UTSW 10 109716642 missense possibly damaging 0.87
R0219:Nav3 UTSW 10 109866930 critical splice donor site probably null
R0310:Nav3 UTSW 10 109767128 missense possibly damaging 0.82
R0380:Nav3 UTSW 10 109758879 splice site probably benign
R0403:Nav3 UTSW 10 109767103 missense probably damaging 0.98
R0480:Nav3 UTSW 10 109853300 missense probably damaging 1.00
R0626:Nav3 UTSW 10 109823464 missense probably damaging 1.00
R0637:Nav3 UTSW 10 109770197 missense probably benign 0.25
R0847:Nav3 UTSW 10 109903857 missense possibly damaging 0.94
R0988:Nav3 UTSW 10 109716528 missense probably damaging 1.00
R1272:Nav3 UTSW 10 109736999 missense probably damaging 0.98
R1295:Nav3 UTSW 10 109692102 missense probably damaging 1.00
R1405:Nav3 UTSW 10 109770333 splice site probably benign
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1420:Nav3 UTSW 10 109823254 missense probably benign 0.02
R1449:Nav3 UTSW 10 109853511 missense probably benign 0.13
R1458:Nav3 UTSW 10 109720044 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1472:Nav3 UTSW 10 109727941 missense probably damaging 0.99
R1537:Nav3 UTSW 10 109866985 missense probably damaging 1.00
R1539:Nav3 UTSW 10 109767170 missense probably damaging 0.99
R1581:Nav3 UTSW 10 109823428 missense probably damaging 1.00
R1586:Nav3 UTSW 10 109853254 missense probably damaging 1.00
R1654:Nav3 UTSW 10 109853123 missense possibly damaging 0.85
R1725:Nav3 UTSW 10 109823590 missense probably damaging 1.00
R1742:Nav3 UTSW 10 109769213 missense probably benign
R1793:Nav3 UTSW 10 109703372 missense probably benign 0.00
R1830:Nav3 UTSW 10 109823323 missense probably damaging 1.00
R1834:Nav3 UTSW 10 109720022 missense probably damaging 0.99
R1881:Nav3 UTSW 10 109852559 missense probably damaging 0.96
R1922:Nav3 UTSW 10 109705606 missense probably benign 0.43
R1944:Nav3 UTSW 10 109716530 missense probably damaging 0.99
R1981:Nav3 UTSW 10 109719090 splice site probably benign
R1985:Nav3 UTSW 10 109770184 splice site probably benign
R1996:Nav3 UTSW 10 109853401 missense probably damaging 1.00
R2051:Nav3 UTSW 10 109824675 missense probably damaging 0.99
R2062:Nav3 UTSW 10 109720021 missense probably damaging 1.00
R2139:Nav3 UTSW 10 109853135 missense probably benign 0.22
R2248:Nav3 UTSW 10 109696227 missense probably damaging 1.00
R2420:Nav3 UTSW 10 109863813 missense probably damaging 0.98
R2444:Nav3 UTSW 10 109764915 missense probably benign 0.09
R3026:Nav3 UTSW 10 109824604 missense probably damaging 0.99
R3052:Nav3 UTSW 10 109903752 missense probably damaging 0.99
R3441:Nav3 UTSW 10 109704928 missense probably benign 0.01
R3845:Nav3 UTSW 10 109853376 missense possibly damaging 0.82
R3929:Nav3 UTSW 10 109684203 missense probably damaging 1.00
R3932:Nav3 UTSW 10 109694035 missense probably damaging 0.99
R4056:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4057:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4120:Nav3 UTSW 10 109903744 critical splice donor site probably null
R4244:Nav3 UTSW 10 109769296 missense probably damaging 1.00
R4361:Nav3 UTSW 10 109852986 missense probably damaging 1.00
R4512:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4514:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4700:Nav3 UTSW 10 109764935 missense probably benign 0.10
R4815:Nav3 UTSW 10 109823552 missense probably benign
R4981:Nav3 UTSW 10 109880692 missense probably benign
R5042:Nav3 UTSW 10 109769268 missense probably benign 0.27
R5251:Nav3 UTSW 10 109853253 missense probably damaging 0.99
R5252:Nav3 UTSW 10 109714291 small deletion probably benign
R5273:Nav3 UTSW 10 109693038 critical splice donor site probably null
R5288:Nav3 UTSW 10 109853105 missense probably benign 0.10
R5407:Nav3 UTSW 10 109866935 missense probably benign 0.28
R5533:Nav3 UTSW 10 109883678 missense possibly damaging 0.61
R5561:Nav3 UTSW 10 109716552 missense probably damaging 1.00
R5577:Nav3 UTSW 10 109769403 missense probably damaging 1.00
R5656:Nav3 UTSW 10 109764633 missense probably damaging 0.96
R5872:Nav3 UTSW 10 109764787 missense probably damaging 1.00
R6023:Nav3 UTSW 10 109823515 missense possibly damaging 0.95
R6061:Nav3 UTSW 10 109866984 nonsense probably null
R6189:Nav3 UTSW 10 109720019 missense probably damaging 0.98
R6214:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6215:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6264:Nav3 UTSW 10 109688833 missense probably damaging 0.97
R6500:Nav3 UTSW 10 109764756 missense probably damaging 1.00
R6524:Nav3 UTSW 10 109720030 missense probably damaging 0.99
R6868:Nav3 UTSW 10 109693166 missense possibly damaging 0.49
R7079:Nav3 UTSW 10 109767292 missense probably benign 0.16
R7099:Nav3 UTSW 10 109703334 missense probably benign 0.11
R7139:Nav3 UTSW 10 109853477 missense probably benign 0.44
X0012:Nav3 UTSW 10 109692097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTATTAGAGGCAGCCAGACCAG -3'
(R):5'- CCCTCCAGGTTTATGTATACCACGC -3'

Sequencing Primer
(F):5'- gattctcaaccttcctaatgtaacc -3'
(R):5'- AGGTTTATGTATACCACGCCTCTC -3'
Posted On2013-05-09