Incidental Mutation 'R4363:Gli2'
ID324976
Institutional Source Beutler Lab
Gene Symbol Gli2
Ensembl Gene ENSMUSG00000048402
Gene NameGLI-Kruppel family member GLI2
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4363 (G1)
Quality Score90
Status Not validated
Chromosome1
Chromosomal Location118834132-119053619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118853370 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 189 (N189S)
Ref Sequence ENSEMBL: ENSMUSP00000124132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062483] [ENSMUST00000159839] [ENSMUST00000160991] [ENSMUST00000161056] [ENSMUST00000161301] [ENSMUST00000161451] [ENSMUST00000162552] [ENSMUST00000162607]
Predicted Effect probably benign
Transcript: ENSMUST00000062483
AA Change: N354S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054837
Gene: ENSMUSG00000048402
AA Change: N354S

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 36 43 N/A INTRINSIC
low complexity region 259 278 N/A INTRINSIC
ZnF_C2H2 417 442 4.98e-1 SMART
ZnF_C2H2 450 477 6.57e0 SMART
ZnF_C2H2 483 507 2.09e-3 SMART
ZnF_C2H2 513 538 4.17e-3 SMART
ZnF_C2H2 544 569 1.84e-4 SMART
low complexity region 637 657 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
low complexity region 930 945 N/A INTRINSIC
low complexity region 1035 1053 N/A INTRINSIC
low complexity region 1428 1435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159839
SMART Domains Protein: ENSMUSP00000125661
Gene: ENSMUSG00000048402

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 36 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160991
Predicted Effect probably benign
Transcript: ENSMUST00000161056
SMART Domains Protein: ENSMUSP00000124768
Gene: ENSMUSG00000048402

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 36 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161301
AA Change: N391S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125342
Gene: ENSMUSG00000048402
AA Change: N391S

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 36 43 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 296 315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161451
AA Change: N189S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124132
Gene: ENSMUSG00000048402
AA Change: N189S

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 36 43 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162552
SMART Domains Protein: ENSMUSP00000125059
Gene: ENSMUSG00000048402

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 36 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162607
AA Change: N215S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123808
Gene: ENSMUSG00000048402
AA Change: N215S

DomainStartEndE-ValueType
low complexity region 120 139 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger protein subclass of the Gli family. Members of this subclass are characterized as transcription factors which bind DNA through zinc finger motifs. These motifs contain conserved H-C links. Gli family zinc finger proteins are mediators of Sonic hedgehog (Shh) signaling and they are implicated as potent oncogenes in the embryonal carcinoma cell. The protein encoded by this gene localizes to the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. The encoded protein is associated with several phenotypes- Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit skeletal malformations, absence of floorplate and foregut, lung and anorectal defects, and altered commissural neuron guidance. Most mutants die before embryonic day 18.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,270,745 S3179T unknown Het
9530053A07Rik T C 7: 28,146,906 S1008P probably damaging Het
Abcc2 G T 19: 43,799,136 W207L possibly damaging Het
Adamts13 G A 2: 27,004,782 C1034Y probably damaging Het
Adgrb3 A T 1: 25,112,222 V1081E probably damaging Het
Apcdd1 T A 18: 62,951,932 I400N possibly damaging Het
Bcan G T 3: 87,997,098 T117K probably damaging Het
Bicc1 ATGTG ATG 10: 70,943,374 probably null Het
Cmtr1 T C 17: 29,674,232 L75P probably damaging Het
Cplx2 A T 13: 54,378,817 T13S probably benign Het
Drd3 A T 16: 43,762,359 I72F probably damaging Het
Dsn1 A T 2: 156,999,142 I214K probably benign Het
Ermp1 A T 19: 29,612,876 W809R probably damaging Het
Fam105a C T 15: 27,664,343 probably null Het
Fbn2 G A 18: 58,149,050 S298L probably damaging Het
Fbxo33 T C 12: 59,204,862 H289R probably damaging Het
Hus1 G T 11: 8,998,676 L242I probably damaging Het
Hyou1 G A 9: 44,380,615 probably null Het
Kirrel C A 3: 87,090,485 E244* probably null Het
Mmrn2 C T 14: 34,397,977 A268V probably damaging Het
Mycbp2 G T 14: 103,248,457 A1023E probably damaging Het
Nedd9 A T 13: 41,317,953 I184N probably damaging Het
Nmnat1 T C 4: 149,473,445 I47V probably benign Het
Olfr339 A T 2: 36,421,532 I45F probably damaging Het
Olfr561 T C 7: 102,775,256 V244A probably benign Het
Pak1 T C 7: 97,883,586 S198P possibly damaging Het
Pank1 A C 19: 34,827,132 V208G probably damaging Het
Pcdhga12 C G 18: 37,766,161 F15L probably benign Het
Recql4 T C 15: 76,706,044 D723G probably benign Het
Rgs22 A T 15: 36,103,874 I147N probably damaging Het
Selenbp1 A G 3: 94,942,749 probably null Het
Sspo A G 6: 48,498,731 Y4927C probably damaging Het
Syk A T 13: 52,640,730 H477L probably damaging Het
Tnfrsf11b T A 15: 54,256,159 T140S possibly damaging Het
Vmn2r-ps69 T C 7: 85,310,492 noncoding transcript Het
Other mutations in Gli2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Gli2 APN 1 118836891 missense probably benign
IGL01686:Gli2 APN 1 118848435 missense probably damaging 1.00
IGL01925:Gli2 APN 1 118853376 missense probably damaging 1.00
IGL02106:Gli2 APN 1 118836735 missense probably benign
IGL02202:Gli2 APN 1 118836866 missense probably damaging 0.96
IGL02255:Gli2 APN 1 118844349 critical splice donor site probably null
IGL02437:Gli2 APN 1 118836003 missense probably damaging 1.00
IGL02615:Gli2 APN 1 118844398 missense probably damaging 1.00
IGL02817:Gli2 APN 1 118836371 missense possibly damaging 0.55
IGL03294:Gli2 APN 1 118837436 missense probably benign
R0055:Gli2 UTSW 1 118890408 intron probably benign
R0055:Gli2 UTSW 1 118890408 intron probably benign
R0164:Gli2 UTSW 1 118890283 intron probably benign
R0233:Gli2 UTSW 1 118835925 missense probably damaging 0.99
R0233:Gli2 UTSW 1 118835925 missense probably damaging 0.99
R0308:Gli2 UTSW 1 118842062 missense probably benign 0.00
R0418:Gli2 UTSW 1 118840490 missense possibly damaging 0.93
R0558:Gli2 UTSW 1 118837649 missense probably benign 0.01
R0600:Gli2 UTSW 1 118840389 missense probably damaging 1.00
R0630:Gli2 UTSW 1 118841918 missense possibly damaging 0.52
R0690:Gli2 UTSW 1 118844460 missense probably damaging 1.00
R0942:Gli2 UTSW 1 118837506 missense probably damaging 1.00
R1061:Gli2 UTSW 1 118854517 missense possibly damaging 0.71
R1104:Gli2 UTSW 1 118853350 missense probably damaging 1.00
R1141:Gli2 UTSW 1 118837937 missense possibly damaging 0.71
R1344:Gli2 UTSW 1 118841936 missense probably damaging 0.98
R1418:Gli2 UTSW 1 118841936 missense probably damaging 0.98
R1565:Gli2 UTSW 1 118841930 missense possibly damaging 0.57
R1605:Gli2 UTSW 1 118854560 missense probably damaging 1.00
R1640:Gli2 UTSW 1 118836524 missense possibly damaging 0.83
R1728:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1728:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1729:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1729:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1730:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1730:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1739:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1739:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1762:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1762:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1783:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1783:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1785:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1785:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1874:Gli2 UTSW 1 119002049 missense possibly damaging 0.83
R1969:Gli2 UTSW 1 118837700 missense probably benign 0.00
R2199:Gli2 UTSW 1 118837648 missense possibly damaging 0.95
R2377:Gli2 UTSW 1 118837125 missense possibly damaging 0.90
R2883:Gli2 UTSW 1 118868144 missense probably damaging 0.97
R2924:Gli2 UTSW 1 118836359 missense probably benign 0.00
R4430:Gli2 UTSW 1 118837244 missense probably benign
R4463:Gli2 UTSW 1 118836008 missense probably damaging 1.00
R4583:Gli2 UTSW 1 118842068 missense probably benign
R4613:Gli2 UTSW 1 118837511 missense probably damaging 1.00
R4674:Gli2 UTSW 1 118836029 missense probably damaging 1.00
R4735:Gli2 UTSW 1 118840322 missense probably damaging 1.00
R4770:Gli2 UTSW 1 118982588 intron probably benign
R4936:Gli2 UTSW 1 118836140 missense probably benign
R5137:Gli2 UTSW 1 118855503 missense probably damaging 1.00
R5228:Gli2 UTSW 1 118836206 missense probably damaging 1.00
R5318:Gli2 UTSW 1 118844470 missense probably damaging 1.00
R5619:Gli2 UTSW 1 118836755 missense probably benign 0.27
R5661:Gli2 UTSW 1 118853302 nonsense probably null
R6005:Gli2 UTSW 1 118842064 missense probably damaging 1.00
R6012:Gli2 UTSW 1 118837715 missense probably damaging 0.99
R6341:Gli2 UTSW 1 118836224 missense probably damaging 1.00
R6357:Gli2 UTSW 1 118841959 missense probably damaging 1.00
R6425:Gli2 UTSW 1 118835894 nonsense probably null
R6513:Gli2 UTSW 1 118855554 missense probably damaging 1.00
R6802:Gli2 UTSW 1 118842065 missense probably damaging 1.00
R6889:Gli2 UTSW 1 118844416 missense probably damaging 1.00
X0028:Gli2 UTSW 1 118837277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGAGATCCAGCCTGGT -3'
(R):5'- TGTTTCAAACTACAGAAGGGAGGAAA -3'

Sequencing Primer
(F):5'- TCCCAGCCTAAGGACAGTG -3'
(R):5'- GCCCAATTTCTGAGTGCAAG -3'
Posted On2015-07-06