Incidental Mutation 'R4363:Abcc2'
ID325016
Institutional Source Beutler Lab
Gene Symbol Abcc2
Ensembl Gene ENSMUSG00000025194
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 2
Synonymsmultidrug resistance protein 2, Cmoat, Mrp2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4363 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location43782192-43840740 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 43799136 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 207 (W207L)
Ref Sequence ENSEMBL: ENSMUSP00000026208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026208]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026208
AA Change: W207L

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026208
Gene: ENSMUSG00000025194
AA Change: W207L

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 100 116 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
Pfam:ABC_membrane 319 591 3.4e-37 PFAM
low complexity region 597 608 N/A INTRINSIC
AAA 661 836 1.77e-8 SMART
low complexity region 906 933 N/A INTRINSIC
Pfam:ABC_membrane 977 1249 5.4e-48 PFAM
AAA 1324 1509 1.33e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129943
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the canalicular surface of the hepatocyte and in biliary transport, and appears to contribute to drug resistance in mammalian cells. Several different mutations in the human gene have been observed in patients with Dubin-Johnson syndrome (DJS), an autosomal recessive disorder characterized by conjugated hyperbilirubinemia. Alternative splice variants have been observed for this gene; however, they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have moderately enlarged livers, elevated plasma and urine bilirubin, and a reduced ability to clear various drugs and carcinogens from the blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,270,745 S3179T unknown Het
9530053A07Rik T C 7: 28,146,906 S1008P probably damaging Het
Adamts13 G A 2: 27,004,782 C1034Y probably damaging Het
Adgrb3 A T 1: 25,112,222 V1081E probably damaging Het
Apcdd1 T A 18: 62,951,932 I400N possibly damaging Het
Bcan G T 3: 87,997,098 T117K probably damaging Het
Bicc1 ATGTG ATG 10: 70,943,374 probably null Het
Cmtr1 T C 17: 29,674,232 L75P probably damaging Het
Cplx2 A T 13: 54,378,817 T13S probably benign Het
Drd3 A T 16: 43,762,359 I72F probably damaging Het
Dsn1 A T 2: 156,999,142 I214K probably benign Het
Ermp1 A T 19: 29,612,876 W809R probably damaging Het
Fam105a C T 15: 27,664,343 probably null Het
Fbn2 G A 18: 58,149,050 S298L probably damaging Het
Fbxo33 T C 12: 59,204,862 H289R probably damaging Het
Gli2 T C 1: 118,853,370 N189S probably benign Het
Hus1 G T 11: 8,998,676 L242I probably damaging Het
Hyou1 G A 9: 44,380,615 probably null Het
Kirrel C A 3: 87,090,485 E244* probably null Het
Mmrn2 C T 14: 34,397,977 A268V probably damaging Het
Mycbp2 G T 14: 103,248,457 A1023E probably damaging Het
Nedd9 A T 13: 41,317,953 I184N probably damaging Het
Nmnat1 T C 4: 149,473,445 I47V probably benign Het
Olfr339 A T 2: 36,421,532 I45F probably damaging Het
Olfr561 T C 7: 102,775,256 V244A probably benign Het
Pak1 T C 7: 97,883,586 S198P possibly damaging Het
Pank1 A C 19: 34,827,132 V208G probably damaging Het
Pcdhga12 C G 18: 37,766,161 F15L probably benign Het
Recql4 T C 15: 76,706,044 D723G probably benign Het
Rgs22 A T 15: 36,103,874 I147N probably damaging Het
Selenbp1 A G 3: 94,942,749 probably null Het
Sspo A G 6: 48,498,731 Y4927C probably damaging Het
Syk A T 13: 52,640,730 H477L probably damaging Het
Tnfrsf11b T A 15: 54,256,159 T140S possibly damaging Het
Vmn2r-ps69 T C 7: 85,310,492 noncoding transcript Het
Other mutations in Abcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Abcc2 APN 19 43784202 missense probably benign 0.39
IGL01611:Abcc2 APN 19 43826629 missense probably damaging 1.00
IGL01800:Abcc2 APN 19 43784295 missense possibly damaging 0.78
IGL02008:Abcc2 APN 19 43821750 splice site probably benign
IGL02041:Abcc2 APN 19 43784235 missense probably damaging 1.00
IGL02528:Abcc2 APN 19 43798504 missense probably benign
IGL02950:Abcc2 APN 19 43825967 missense possibly damaging 0.83
IGL03081:Abcc2 APN 19 43782402 utr 5 prime probably benign
IGL03397:Abcc2 APN 19 43784304 missense probably benign 0.00
loser UTSW 19 43839411 utr 3 prime probably benign
nelson UTSW 19 43803739 missense probably benign 0.07
Sore UTSW 19 43798194 missense probably benign 0.22
PIT4453001:Abcc2 UTSW 19 43803782 nonsense probably null
PIT4519001:Abcc2 UTSW 19 43819397 missense possibly damaging 0.81
R0197:Abcc2 UTSW 19 43826614 nonsense probably null
R0326:Abcc2 UTSW 19 43825947 missense possibly damaging 0.90
R0391:Abcc2 UTSW 19 43821605 splice site probably benign
R0558:Abcc2 UTSW 19 43800724 missense probably benign 0.00
R0577:Abcc2 UTSW 19 43819401 missense probably damaging 1.00
R0787:Abcc2 UTSW 19 43798516 critical splice donor site probably null
R1189:Abcc2 UTSW 19 43819413 missense probably damaging 1.00
R1200:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1395:Abcc2 UTSW 19 43833940 missense probably benign 0.22
R1606:Abcc2 UTSW 19 43836652 missense probably damaging 1.00
R1775:Abcc2 UTSW 19 43798419 missense possibly damaging 0.88
R1797:Abcc2 UTSW 19 43814786 missense possibly damaging 0.81
R1797:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1826:Abcc2 UTSW 19 43822014 missense probably benign 0.01
R1882:Abcc2 UTSW 19 43798506 missense probably benign 0.00
R1913:Abcc2 UTSW 19 43807244 missense probably benign 0.10
R1986:Abcc2 UTSW 19 43829879 missense probably damaging 1.00
R1991:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R1992:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R2006:Abcc2 UTSW 19 43805061 missense probably damaging 1.00
R2057:Abcc2 UTSW 19 43818038 missense probably damaging 1.00
R3709:Abcc2 UTSW 19 43798446 missense possibly damaging 0.80
R3802:Abcc2 UTSW 19 43821626 missense probably benign 0.01
R4010:Abcc2 UTSW 19 43829864 missense possibly damaging 0.75
R4014:Abcc2 UTSW 19 43823120 missense probably benign
R4064:Abcc2 UTSW 19 43804993 nonsense probably null
R4296:Abcc2 UTSW 19 43823074 missense probably damaging 1.00
R4296:Abcc2 UTSW 19 43823075 missense probably damaging 1.00
R4580:Abcc2 UTSW 19 43811119 missense probably damaging 1.00
R4625:Abcc2 UTSW 19 43803739 missense probably benign 0.07
R4631:Abcc2 UTSW 19 43814707 missense possibly damaging 0.70
R4671:Abcc2 UTSW 19 43800718 missense probably benign
R4715:Abcc2 UTSW 19 43816882 missense possibly damaging 0.54
R4726:Abcc2 UTSW 19 43832114 missense probably benign 0.23
R4760:Abcc2 UTSW 19 43810481 missense probably benign 0.03
R4801:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4802:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4976:Abcc2 UTSW 19 43800635 missense probably benign 0.34
R5143:Abcc2 UTSW 19 43821661 missense probably benign 0.28
R5206:Abcc2 UTSW 19 43818150 missense probably damaging 1.00
R5376:Abcc2 UTSW 19 43829900 missense possibly damaging 0.76
R5478:Abcc2 UTSW 19 43839465 utr 3 prime probably benign
R5700:Abcc2 UTSW 19 43798194 missense probably benign 0.22
R5863:Abcc2 UTSW 19 43798136 missense probably benign 0.00
R5928:Abcc2 UTSW 19 43819358 missense probably damaging 1.00
R5955:Abcc2 UTSW 19 43813190 missense probably damaging 0.98
R5983:Abcc2 UTSW 19 43819503 missense probably benign
R6014:Abcc2 UTSW 19 43826735 missense probably benign
R6419:Abcc2 UTSW 19 43837508 unclassified probably null
R6497:Abcc2 UTSW 19 43805105 missense probably damaging 1.00
R6510:Abcc2 UTSW 19 43782206 utr 5 prime probably null
R6614:Abcc2 UTSW 19 43819361 missense probably benign 0.01
R6649:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6653:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6670:Abcc2 UTSW 19 43839411 utr 3 prime probably benign
R6964:Abcc2 UTSW 19 43798076 missense probably benign 0.12
R6989:Abcc2 UTSW 19 43832172 missense probably damaging 1.00
R7015:Abcc2 UTSW 19 43798178 missense probably benign 0.03
R7026:Abcc2 UTSW 19 43816953 missense probably benign 0.00
R7026:Abcc2 UTSW 19 43830535 missense probably benign 0.01
R7136:Abcc2 UTSW 19 43837460 missense probably damaging 1.00
R7252:Abcc2 UTSW 19 43827949 missense probably damaging 0.98
R7293:Abcc2 UTSW 19 43807053 missense probably damaging 1.00
X0025:Abcc2 UTSW 19 43832205 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTTAGCGTCTCCGGGTAAG -3'
(R):5'- CATTCTAATCAATCCAACCAAGGGG -3'

Sequencing Primer
(F):5'- GTTAGCGTCTCTAGGTAAGCACAC -3'
(R):5'- CCACAGGAGGCGTTTTTAA -3'
Posted On2015-07-06